Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig1774
Contig Information
Length 1679 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whhg3h07    whhg6l21    rwhhg3h07    rwhhg6l21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11566 [Oryza sativa Indica Group]
Score 1801
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig1774
ATACTAGCAGATGTTATAGATGAGAGCACAGCATTGGGCCTCTTAAAGTGACTGCTCACCACTTGCAAGTTTCGAATTGTAGGGTTCGTCGCTGCTAATC
CTAATGTGGCATTCCATTCTACATGAACGGCAAGTACCAAAACTTTCAGACAAAGATGATAGTACAGCATTACACCACAAATTTCCGCCGTATCTCCGTG
CCGCTCACTCATCAGCGTGCTTCTTCTTTTTCTTCTTCTCCTTCTTGGCAGACACGTCGATCTCCATGGGTGCATCCTCAGCGTCCAATTTCTTCTTTTT
TTTCTTCTTCTCGCCATCGGCGTCGGCTGCAGGGGTCTCCTCGGCCTCCTTGCTCTTCTTTTTCTTCTTCTTCTCGCTAGCGTCGGTGACGGCTGCGGGG
GTCTCCTCGATGTCCTTGGATTTCTTCTTCTTCTTCTTGGACTTCTCTTTCTCCTGCTCGCCATCCTCTTCAGCTGCCTCCGCAGTAGGTTCTTCCTCTT
GGTGCTTCCTCTTCTTTGAAGCAACTTCTGACTTCTTTGGCGTTTCTTCAGTGGTTTGTCCAAGCACAAGATCTGCTGCTGAGTTGTAAGTTTTAGCGGG
AGTGATCAGAGCACCACCACCCTTCCGGTCCTTTTCATACGCTTCTATCTTGGGCTTTCCTTTCGTAGAACCAGCAGACCTCCCAAGTTCTTTACCCTCA
AGAACTCGGAGCCGTGTTTCAAGCTTGATCCTGCTTTCAAGACCCATGGAGTTATCGTCACCGTCAGCAAGGGCGTCATATCTTATGGCAAGTGCACTCT
TAGCAGCAAGCGAACGAGAGATCTTTCCCTTGTGCTTCGGAGCCGCCTGTCCAATTAATGATGCATGATAGATGAGACCATACTTTGGTGTAGCATGCTT
TGTCTTCAGAGCTCTGAATAAGGCCTTCTCTGCCCCCAGAATCTGAATAGTGCTGCCAGGCTGCTTCGCCAGATTCATCAAACTACCACCATGGGAAATA
AGGCGAGCGCCAACAAGTTCACCAACAAGTGCAGTCAAGTTGGGAGCAATGGTGTTCATCCTACTTTTTAGATAGTCATAGAGCTGGCCTCTGTACTCAG
AAAGAGCCAGGACTTGATCACACAGTTCCCTAATGTTTGAGAGGTCAAGATCATTAACTTCTGTTCCCATGGAAATGACAGCTGCTTCCTTCAGCTCTGC
TTCCACATCTTCTGGCAGTATCTCAGAGAAGTCAAGGTTAACTGCATTAACACGATTGCCCATCATCTTCACAGCTTTCGCGTAATGGATATTATCTGCA
ACAATTTTTGTGAGCTCCGGAAAGTGCCAACCGTACCATTCACGGACCCTCATAGCATAAGTGTTAAGCTCCTTGTCAAGATCATCCAACAAGCCAATGG
CCTGAATGATCATAGTATCAACCTTTTCAGGGCTGAACTTGAGTTTATACCTAGACAAGCTGTGGGACAATCCTAGGCTCATTGGACCTAGATCATGCTC
AGCTAGTCCAGACATAAGTTCAGTGAGCTGGTTCCTCAGCCCTCTCATCAGTTCCATAACAGCAGAGTTGTGAAGGCAATCAATTTGCAGCTTTTCTTTG
ATGGCATTCCCAAGTTTGGAATCAGCAACAGCCAATGTTTCACCATCACAGTGCTTCTGCAGGAACTTGCGCAGACCCT
page-top