Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1907
Contig Information
Length 745 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 17 Clones [Download: CSV  ,  FASTA ]
rwhfl53a21    rwhfl7b19    rwhfl54g16    rwhfl48p09    rwhfl38m08    rwhfl40l02    rwhfl40l13    rwhfl49p09    rwhfl21b15    rwhfl21b04    whfl54g16    whfl53a21    whfl7b19    whfl10g06    whfl48p09    whfl40l13    whfl40l02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192679 [Zea mays] >gi|194691302|gb|ACF79735.1| unknown [Zea mays] >gi|195605366|gb|ACG24513.1| nuclear transport factor 2 [Zea mays] >gi|195605650|gb|ACG24655.1| nuclear transport factor 2 [Zea mays] >gi|195605666|gb|ACG24663.1| nuclear transport factor 2 [Zea mays] >gi|195611100|gb|ACG27380.1| nuclear transport factor 2 [Zea mays] >gi|195618194|gb|ACG30927.1| nuclear transport factor 2 [Zea mays] >gi|195622818|gb|ACG33239.1| nuclear transport factor 2 [Zea mays] >gi|195644142|gb|ACG41539.1| nuclear transport factor 2 [Zea mays]
Score 441
Evalue 3.23017e-50
Total Hit Count 359
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1907
gtgaacttaaatGGTCACAAACAAAACCCAG*AGATGCCACACATAA*CTAATACCTGGACGGTTTCCATCAACATTCCAAAGAAAGTGCCACCCAAGCA
ACGACAATACATGGGAAACACAAAACAAAAGAAGATCTGGTGGATGCCTATCAAGTCTGGCAATTTTTT*GCGATAAATTGCACAAGCTGGCGAACAAAC
AAAGAGTCTGCAGCATCATCATTTGATGTTCATTGTTTCAACATAAATCCCTGAACAAGTTCTTTGCCGCCAGAGCGGTCGCCCTTCCTTAACCATAGTT
CAGGCGGAACATGTCGTTCTGCACGTAGAAGCTCCCTCCAGCTGGCAGCAAATGGAACATCTGTGAGAACTTGAGGGGGTGCTCGCCGGGGCCGGTGGTG
ATGGTGCCGGAGACGAAGACGAGGACGCCGCCCTGGGGCCCCGAGGGCTGGCAGTCGACGGTGTCGATCTTGTGCTGGCACTGCTGGAAGGGGAGAGATC
CGAGCTT*G*CCGGCG*A*TGGCGGCGGGGCCGCCGAACTTCTCGCCCTCGAAGGTGAGCATGGAGCCGTCCTGGTACAGCCCCACCAGCCGCGGCGCGG
TTGGAGTCGAACGTGTGGTAGTAGTGCTGCACGAACGCCTTCGAGACCGAATCGGGATCCATGGCCTCTCCCTCCTCGCCTCGCCTCGCCTAGGGTTTGG
AGCTCTGGATGCGTAGGCTTTGGGCGTTGGGAGCCGGAGTTTGgt
page-top