Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig1628
Contig Information
Length 1214 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whhg6f06    whhg9m11    rwhhg9m11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit splicing factor [Oryza sativa (indica cultivar-group)]
Score 670
Evalue 3.95373e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig1628
GGTTTCCTCCGCTTCGCTCTCGCAGAATGCCTCGCTACGATGAGCGTGATCGTTATGGCGGCAACACAAGGCTGTACGTGGGTCGTCTTCCGTCGCGCAC
CCGCACAAGGGACCTTGAAGACCTCTTCGGCAGATATGGGAGAGTGCGACATGTGGATATGAAGCACGAGTTTGCATTTGTTGAGTTTAGTGATCCCAGG
GATGCTGATGAAGCAAGGTACAACCTTGATGGTCGTGACTTTGATGGAAGCCGCATGATTGTTGAGTTTGCTAAAGGGGTTCCGCGTGGCCAAGGAGGAG
GAGGTGACCGTGACCGTGGCCGTGGTGGTGACCGTGAATATATGGGTCGGGGACCTCCTCCTGGTTCTGGCCGTTGCTTTAACTGTGGGATTGATGGGCA
TTGGGCTCGTGACTGCAAAGCTGGCGACTGGAAAAATAGGTGCTATCGTTGTGGAGATAGTGGCCACATAGAAAGGGATTGCCAGAACAGCCCTAAGAAC
CTCAAGCGTGGAAAGAGTTACTCCAGATCTCCATCTCCTCGCCGTGGAAGGGTGCGTGATAGGAGCTACAGCAGGAGCCGCAGTAGGAGCTACAGCCGCT
CTGTTTCCCCAAGGAGGGATGAAAGGCGATCAAGGAGCCCCCGTGACAGTCGCAGCCCAAGGAGGAGCCCCCGTGACAGTCGCAGCCCAAGGAGGAGCCC
CCGTGACAGTCGCAGCCCCAGGAGGAGCCCCCGCGACAGTCGCAGCCCTATGAAGAGCCCCCGTGGCAGTCGCAGCCCTATGAGGAGCCCCCGTGACAGC
CGCAGCCCTAGGAGGAGCGCTTCACCTGCCAAGGGGAGGGCCCGGAGCCCCACCCCTCCTGGCAGCAGGAGCCCTGCACCAAGGGAAAACAGCAGGAGCC
CAATGAAGGCTGACAGCCCTAATAACATGAGCCCAGCTGCAAATGGTCGTAGCCCGAGCCCCAGGGACGGCGAAGACAATGGCAACCACCGTGCACCCAG
TGGAAGTGCATCACCCGGTGGTGGTTGAGAGATGGATCGAAATCCTTCCGGTGTTCACCCAGTTGAAGTTCACCTGGTGAGGGTCGAGAGATGGATCAAA
TTCTTCCTACTGCTACGAAACTCTCTAAACATGTTGAACAAAGACTTGCCTGTACGAGTTTGATTTTATTGTGTACTCTATTTCGGTATTGATACTCCAG
TCAGACCATAATAT
page-top