Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig1618
Contig Information
Length 1131 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whhg7o18    whhg15f21    rwhhg7o18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0615200 [Oryza sativa (japonica cultivar-group)] >gi|23237931|dbj|BAC16504.1| unknown protein [Oryza sativa Japonica Group] >gi|113611804|dbj|BAF22182.1| Os07g0615200 [Oryza sativa (japonica cultivar-group)] >gi|215696974|dbj|BAG90968.1| unnamed protein product [Oryza sativa Japonica Group]
Score 760
Evalue 1.29657e-78
Total Hit Count 234
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig1618
ATCCCGCACCGCACGACAGACAGACAGCACGAGGAAGGCGAGCCAACCACCCACCACCGCCGCGAGACTAGCACCACGAGCGAGCTCGGCCGATTCCGAT
TCCGTCTGCGCTATTAAGGTTTGTTTGGAGGAAGGGGAGGAGTCTCGGAGGTGGAGCTGAGGAGAGAGACCGGAGATGGCGGCTTCCGCGAGGCAGGGGG
AGATGGCGACCAGCTTCGCCATGGCCTGCAGCCTGCTCAGCCGCTACGTCCGCCAGAACGGCGCCGCCGCCGCCGAGCTCGGCCTCGGAATCAACAAGGG
TGAGGCCGAGGCACAGAGGGCGGCGGACACGAAGAGCCCTTTGCCCGGAGCGGAGGGCGAGGAGGCGGGTAGGAAGAAGGAGACCATGGAGCTGTTCCCG
CAGAGCGCCGGCCTGCAGGACGCCGCCGCCCCTGATGCTACCAGGGAGGAAGACAAGAGCCAGCTGACCATCTTCTATGGTGGGAAGGTGCTCGTGTTCA
ACGATTTCCCAGCCGACAAGGCAAAGGGCCTGATGCAGTTGGCTGGCAAGGGCAGCCCTGTTGTTCAGAACGTCTCTGCGACCACAACTGCTGCAGACAC
CGACAAGGTCCAGACGGCCGTGCTGGCCCCAGCAAGTAGTTTGCCTACTGGTCCGGTTGATGCTCCTAAGCCTGCTCGTCCGAATGCTTCTGATCTGCCA
ATTGCTAGAAAGGCGTCACTTCACCGATTCCTTGAGAAGAGAAAGGATCGTCTCCATGCAAAGGCACCATATCAAGCTCCTCCTTCTGATGCAACACCAG
TCAAGAAGGAGTTTGAGAACCAGCCATGGCTTGGACTAGGGCCGAATGCCGCCCTGAAGCCAAACCAATAAGACGGCATGACAGGAGCCTTATGCCCTTA
CCAGAAATATATCTGAAATGTGCTTTGTCCTTAGAAGTATCAAGTCATGAATATTTTATCCCATATCATGTTCTAGCGTTTTGTTTAGGTTATGGTTCTA
TGTTATTCGCCTCCATAGTTCCGATGTAAAGAGAAGTAGCAAATGATGATGACCGGTGCCCGAAGCCCGAGAGAAGTTTTGGCATGTTAACACATGGTGA
TATTGAGTTGGCCATGCTAAGGAAAAAAGTA
page-top