Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig1578
Contig Information
Length 754 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
rwhhg5m10    rwhhg14o24    rwhhg20p03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cobalamin-independent methionine synthase [Triticum monococcum]
Score 731
Evalue 1.51139e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig1578
ATGATGACAATTCGCCACTCAGTTTACAATACACACCGACAACCGCCTCAAAAACCACCAAATCAAAGGGATGAGCACATGGCGCCGCGCCGCGCCGAGA
AACAAACTAGCCTAACCAACAGGTGGATACAGAGACCCAGATTATTCAAAGTAAACACGGCTATGGTGGCGACATCCTCCTTGCAATTAAAATGGGGGAG
CTGCTATACGGCTTACTGCGCCTTGGCGAGCTCGGCGCGGATCTGCTTGGCGGCCTCGACCATGTTGGTGAGGGCGGGCTTGACCTCGGCATACTTGCGG
GTCTTGAGACCGCAGTCGGGGTTCACCCACAGGATGTTGGTGTCGAGCACCGCGAGCATCTTGTTGACACGGTCGGCGATCTCCTCCTTGGACGGGATCC
TGGGGGAGTGGATGTCGTACACGCCCGGGCCAATGCCGGCGCCGTACACCACGCCCTCGCGGAAGACGGAGAGAAGCTTCTCGTCGGACCGCGAGTTCTC
GATGGTGATCACATCGGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGAAGTTGGAGTAGCACATGTGGGTGTGGATCTGGGTGGTGTCCTGGACA
CCGCANNTGGTGATCCTGAANGANTGCACNGNCCANTCCAANTANAAANNATGCTCCNACTTGNNNANTGNNANANCCTCTCTCANANCANNCTCNTCNA
TTTNNATANNTNAATACNNNCNNNCTCNNNGNNNTCNACCTCCTTNTTNATTGC
page-top