Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig19
Contig Information
Length 617 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl55g21    rwhfl55g21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0116900 [Oryza sativa (japonica cultivar-group)] >gi|41052832|dbj|BAD07723.1| putative 15.9 kDa subunit of RNA polymerase II [Oryza sativa Japonica Group] >gi|113535214|dbj|BAF07597.1| Os02g0116900 [Oryza sativa (japonica cultivar-group)] >gi|125537811|gb|EAY84206.1| hypothetical protein OsI_05586 [Oryza sativa Indica Group] >gi|125580570|gb|EAZ21501.1| hypothetical protein OsJ_004984 [Oryza sativa (japonica cultivar-group)] >gi|215768240|dbj|BAH00469.1| unnamed protein product [Oryza sativa Japonica Group]
Score 582
Evalue 1.87043e-58
Total Hit Count 155
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig19
cctcTTCAACTCCCGTCTCacctcTCCCGACGCCGAACCGAATCGCAGCAGCGGCAGCCGGAGAAGAAGAGATCGAGCGCCAGCAGCCATGTCCGGCATG
GAGGAGGAGGAGAACGCCGCCGAGCTCAAGATCGGCGAAGAGTTCCTGAAGGCCAAGTGCCTGATGAACTGCGAGGTGGCGATAATCCTGGAGCACAAGT
GGGAGCAGCTGCAGCACATGTCGGACGGCGGCGCCGACCAGGTCTCGCAGGTCTTCGAGAAGTCGCAGGCCTACGTCAAGCGCTTCAGCCGCTACAAGAA
CCCCGACGCGGTCCGCCAGGTCCGCGAGACGCTCTCCCGCTACAGCCTCGTCGAGTTCGAGCTCTGCACCCTCGGGAACCTCTGCCCCGACACCGCCGAC
GAGGCCAAGGCGCTCGTCCCCTCCCTCGTCCCCGGCGGCAGGTTCGACAGCGACGACCGGGTCGACAAGATGCTCAACGACCTCTCCCTCATCAAGAAGT
TCGAGTAGTAGCCCCCATAATATGCTCTTcttgtcttcctccagtgatatgtttaagcttcagattatctccttttattgcgctatgatcataagacatc
agttcagtctcaaagaa
page-top