Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig1524
Contig Information
Length 896 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
rwhhg2h16    rwhhg5m14    rwhhg10c09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glyceraldehyde-3-phosphate dehydrogenase, cytosolic >gi|18978|emb|CAA42901.1| glyceraldehyde 3-phosphate dehydrogenase [Hordeum vulgare]
Score 1107
Evalue 5.2304e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig1524
AGGCAACACAAGTACTGGGACTGAACGATTTATATATTCTTCACAAACCACAACCAAAAAAGAGTACTTGATTAGCAACTCCATTACAGATACTAGTTGA
TGCGGAAAACAGAAGGTAACTCATGTCCAACTAACATGAACCAGGCGTCGTCTGGCGACGCCATCCACATTTATTCTTCGCATAGACAAAGCAGGGACAC
CTCTGACCAGGCGCCACAAAGGAAAGCAGAGCACTCTACTGAGTCTTGGCCATGTGGCGGATCAGGTCGACAACGCGGTTGCTGTAACCCCATTCGTTGT
CATACCACGAGACAAGCTTGACGAAATGGTCGTTCAGAGCAATTCCAGCCTTGGCATCAAAGATGCTCGACCTGCTGTCACCAACAAAGTCGGTGGAGAC
CAAATCCTCCTCAACGTAACCCATGATCCCCTTGAGCTTCCCCTCAGATGCAGCCTTGATAGCCTTCTTGATGTCATCATATGATGCAGCCTTCTCGGTT
CTAACAGTGAGATCAACAACTGACACATCCACAGTGGGAACCCGGAAAGACATACCGGTAAGCTTGCCATTCAGCTCAGGAAGAACCTTACCAACAGCCT
TAGCAGCACCAGTGCTGCTGGGAATGATGTTAAAGCTTGCGGCCCTGCCACCTCTCCAGTCCTTGCTCGAGGGACCATCAACGGTCTTCTGTGTGGCAGT
GATGGCATGAACAGTGGTCATCAAACCCTCAATAATACCGAAGTTGTCATTAATGATCTTAGCTAGGGGAGCAAGGCAGTTAGTGGTGCAGCTAGCATTT
GAGACAATGTTAACGTCTGAGGTGTACTTGTCCTCGTTGACACCAACCACAAACATAGGGGCATCTTTGCTTGGGGCANAGATGACCACCTTCTTG
page-top