Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1887
Contig Information
Length 673 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 16 Clones [Download: CSV  ,  FASTA ]
rwhfl50h13    rwhfl37n14    whfl37n14    rwhfl45p12    whfl45p12    whfl10c19    whfl36k04    whfl6m04    whfl12n13    whfl50h13    rwhfl6m04    rwhfl12n13    whfl50h14    whfl6n03    rwhfl36k04    rwhfl50h14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit amino acid adenylation domain [Burkholderia ubonensis Bu]
Score 81
Evalue 2.83047
Total Hit Count 5
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1887
ttcACGGTGGACGGACATTTTTTTTCTCCCCAACC*AGCGAGGAAGAGGAAGAGGAAGCGGATCGAGTCGGCGAGAGCGAGGGCGAGGACGATGGCGGCG
CTCCGGCTAGCGGTGAGGAGATTTTGCGACCGTGCGCTCGGGAGATCAGCGGGCATTTACGAGCTCAAGGCTGCCAAGGAATTCCCCGACATTGATCCTG
GGCATCTCAAGGCTGCCAGGAAATTCCCCAAACTTCGTGTCAAGGATGTTGATGCTACGGCTCTGAATGTCTTCAAGATTCTCAGGGAGAGTCCAGTCGA
TGGTCATAAAGATGTAACCCTTCGTGAAGTGCGCATGACACTCAAGACCTTGGCTGAGATTCAGGAAGAAGAATGAAGATGCGCTACTAGGAAGCAATAT
CGTCTCTTGCTCTAATATGAACTAGCTTTGCAGTATTGTAGTATTTGAATCTTTCCTATGTTGTCGCTCTGTGTCTCGATCTTCAAAACTGCTGGACGGA
TGTGATGTTTTGCTATTTTCTTGCTTCGCAAGGTTGAATCATCCTTTGATCTTGACATGCCCACCAGATTCGAGTGTAAGCTTTCGGGCTAGCGATAAGG
GCGGCATGTACTTGGTATTCGTAAGATTTGCTGGATGCTTGTACTCAGTTTCCTTAAATTATAAAATACTAta
page-top