Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1878
Contig Information
Length 1052 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 16 Clones [Download: CSV  ,  FASTA ]
whfl39a18    whfl44p04    whfl39a17    whfl33o02    whfl10b14    whfl28e07    whfl31j08    whfl32o02    rwhfl39a18    rwhfl31j08    rwhfl39a17    rwhfl10b14    rwhfl32o02    rwhfl44p04    rwhfl28e07    rwhfl33o02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Hypothetical protein CBG21295 [Caenorhabditis briggsae]
Score 92
Evalue 0.334115
Total Hit Count 6
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1878
aaccgggtGTTCCAAGTACTGGCTTTGACGAACGGCGCTTGGGGTAAAAAGAAAAAGTAATTCTCAGAGACGCTATTTTCCCCTCGATTCGTGGCCGGAG
AGGGTTGTACTCATTGCGACGGCGGAGGCGACCGGGGATGGGTTCGAGTTCTTATCAGATCCGGTTGATAGATTCCCTGTGCTGGCGTTGACGGCGGTGA
CTACGTGCCACCGGCGCAGCCCGCTCCAGATCTGCTGGGATATAGCAGGCGAGTCTAGCATTGATGATGTGGGCGACCGGCCGCCGGCGCTCCAAGTAGA
ACTGAA*CGGCGTTTGCTCGAGCATTAGCTTGTTGGTGCCGGACTTAGAAC*AGTGAACAGGCAAGGACGACCGGCAAGCACCGGCGAGG*AAGAAAGAG
GGCTCGTGTTGCACGGCCGCCTACAGAACGGCCACCATGCATGCATTGGCAGAGTGTGCACATTCAGGGGATACGCAGAGAAGCATGCTGAAACTGTGGA
GGAAACATCATGTTGAATGGAGACACCAATATGGTTTAGCGGTCCGTCACGTCCCGTCCCCGTCTTCACCTCCGTCGATCGCCCGCGCCTATCTCGTCGC
CGGCACCACCGTGTGCGGTGGTTTTGGTATCCGCCCCCGTCGGCCCTCGTCCTGTCTATGATTCAGATGTGGAGGTTGTTGAACCGGAAATTCCAACCGA
CCCTATTGTCGAGAGGTTAAATTGAGTTGAAGAAGAAAACAATTTGTTGAAGGAAAAAATTAAAAAAATTGAGGAGGCGAAGATGATATTGGAGTTGCAT
GTTGCGGATGTCGTCGATGATCACAAGATCAAGATGGATGCAATGCGCTTGAAGATTAGAAAGATTAGAAAATATGCCATTCATACCGAGGCTTGGTATC
ATTATGCCGTTGGATCAGTTGTTACATTGGTTGCGATTATGATCGCATTTGTTTTCGCATTGAAATGTTTTACATAGTTTCAGTGTATGGTTTAATTAAT
TTAGATGCTCTGCAGAGCTTTATGTTGTTAGATGAGAACTATGTATGTActt
page-top