Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1862
Contig Information
Length 962 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 15 Clones [Download: CSV  ,  FASTA ]
whfl54g03    whfl10d14    whfl38m06    whfl9g14    whfl24l21    whfl39g12    whfl29e23    whfl30e23    whfl3b20    whfl4b20    rwhfl5o21    whfl18f19    rwhfl29e23    rwhfl21j08    rwhfl3b20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein Bm1_17870 [Brugia malayi] >gi|158598170|gb|EDP36122.1| hypothetical protein Bm1_17870 [Brugia malayi]
Score 231
Evalue 2.22227e-17
Total Hit Count 29
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1862
tcatcgtacctggttgATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGTATGAACCAATTTGAACTGTGAAACTGCGAA
TGGCTCATTAAATCAGTTATAGTTTGTTTGATGGTACGTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGG
AGGGGCGCATTTATTAGATAAAAGGCTGACGCGGGCTCTGCTCGCTGATCCGATGATTCATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGCGACG
CATCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGGGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGG
AGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCG
CATTAGTGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCC
ACGGCCCTCAAGGTGAAAGGTCTCCACGACCATGTGGACGCCCGTTACAAGGCTCTCGACAAGCGACTTGCAGCTCTGGAAGCCCAGAAAAGCACCGACT
CCTCTCCGGCTGTGGACGCGCCATCGGGCTAGTCGTCCGTCTGTGGACGCGCCATTGGGCTAGTCGTCCGTCTGTCCATCACGAGGCTTGACAAGTGGAT
GATTCAAAGTTTGTTTACTTTTAACATGCGCGCGCTATCTGCTTCTCCTTTGAAGGCAAGGGGCCTGTGACTGACAGCGAAATAATCTAGCCAATGGTTT
TTATTTTGTTGTTTGGGCAAGAAGAATCTTGTTTTTTGTTGCATGATGATGGGatacatcag
page-top