Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig1177
Contig Information
Length 974 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whhg9i02    rwhhg9i02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Unknown (protein for IMAGE:5194336) [Homo sapiens] >gi|111494016|gb|AAI11385.1| Unknown (protein for IMAGE:5198300) [Homo sapiens]
Score 1320
Evalue 1.20039e-143
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig1177
CCGGTTTTCATTGTTTGGAGAACACACAATACACCTCCCACCTTAGCAGCGCAATGGCGACCACCACCATGTCCCTCTCCTCGACCTTCGCCGGCAAGTC
GGTGAAGAACGTGGCTTCATCAGCTCTCTTTGGTGAGGCCCGTGTCACTATGCGCAAGACCGCTGCAAAGGCCAAGCCGGTTTCATCAGGTAGCCCATGG
TACGGTGCCGACCGTGTGCTCTACCTTGGCCCGCTTTCCGGAGAGCCCCCGAGCTACTTGACCGGCGAGTTCCCCGGCGACTACGGATGGGACACCGCCG
GGCTCTCGGCCGACCCCGAGACCTTTGCCAAGAACCGGGAGCTCGAGGTGATCCACTGCCGGTGGGCCATGCTCGGTGCGCTTGGATGTGTCTTCCCCGA
GCTTCTTGCACGCAACGGCGTCAAGTTCGGCGAGGCGGTATGGTTCAAGGCCGGTTCCCAGATCTTCAGCGAGGGTGGCCTCGACTACCTGGGCAACCCC
AGCCTCGTGCACGCACAAAGCATCCTTGCTATCTGGGCATGCCAAGTCGTGCTCATGGGCGCTGTTGAGGGGTACCGCATTGCTGGCGGCCCACTCGGTG
AGGTAGTCGACCCACTCTACCCCGGGGGCAGCTTCGACCCACTGGGCTTGGCTGACGATCCAGAGGCATTCGCGGAGCTCAAGGTGAAGGAAGTCAAGAA
CGGTCGCCTCGCCATGTTCTCTATGTTTGGCTTCTTCGTGCAGGCCATCGTCACCGGCAAGGGCCCACTCGAGAACCTCGCTGACCACCTCTCCGACCCT
GTCAACAACAACGCATGGGCGTTTGCCACAAACTTTGTCCCCGGCAAGTGAGGCGTTGGCGCTCGCTAGCTGCGAGTTGTAGCCATATATCAAGGCAACT
GCGGTGAACTGCACACATAATGGGTGGTTCAAATTGTAACATCATGGTGTAAATTACAAGGATCTTGGGAAATG
page-top