Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig1168
Contig Information
Length 977 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whhg9g24    rwhhg9g24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein S6 [Zea mays] >gi|195618252|gb|ACG30956.1| 40S ribosomal protein S6 [Zea mays] >gi|195625928|gb|ACG34794.1| 40S ribosomal protein S6 [Zea mays]
Score 873
Evalue 8.20777e-92
Total Hit Count 380
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig1168
CCTCGAGCACCGCGCCGCCGCCGCTCCACCCAGCGTTCGGGTTGCTCGCCGCCGGCGATCTCGTGCCGCGACTCCACCATGAAGTTGAACATCGCGAACC
CCACCACGGGGTGCCAGAAGAAGGTCGAGATTCGATGACGACCCAGAAGCTGCGCAACCTTTATGACAAGAGAATCTCCCCAGGAGGTAGTTGGTGATCT
TCTGGGTGAGGAATTCAAGGGTTACATCTTCAAGATCATGGGTGGCTGCGATAAGCAGGGTTTCCCGATGAAGCAAGGAGTGCTAACTTCTGGGCGTGTC
CGCCTTCTGCTTCACAGGGGCACACCTTGCTTCCGTGGTTTTGGCAGGCGTAATGGTGAGCGCAGGCGGAAATCCGTCCGTGGTTGCATTGTCAGCCAAG
ACCTATCTGTTATCAACTTGGTCATTGTCAAGAAGGGTGAGAATGATCTGCCAGGCCTTACTGACACTGAGAAGCCCAGGATGAGGGGACCCAAGAGGGC
TTCCAAGATCAAGAAGCTCTTCAACCTTGGCAAGGACGATGATGTCCGCAGCTATGTCAACACGTACCGCAGGACCTTCCTTAACAAGAAGGGCAAGAAG
GTGAGCAAGGCTCCCAAGATCCAGCGTCTTGTGACTCCCTTGACCCTCCAGAGGAAGCGCGCCAGAATCGCAGACAAGAAGAAGAGGATTGCCAAGAAGA
AGTCCGAGGCTGCGGAGTACCAGAAGCTGCTTGCACAAAGGCTGAAGGAGCAGAGGGACCGCCGGAGTGAGAGCATGGCCAAGAGGAGGTCGAAGCTTTC
TGCTGCCACCAAGGCTCCTGCTGCCTCTGCTTAAGATGGTTACAGTCCTTTGCACTTTGTTGGAAAAATCTACCCGCTACTTTCAGTTTTCTTGGGTTGG
TAATTGTTGCAATTTTGCGTGAAACATGGGTACTTTATCATTGTAAGTTTTGTTACTGGAGTAGCTTTCTTGGGTTT
page-top