Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1858
Contig Information
Length 572 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 15 Clones [Download: CSV  ,  FASTA ]
whfl19o08    whfl10d15    whfl4l02    whfl5f09    whfl50c06    whfl26h11    whfl35l15    whfl32m06    whfl29l06    whfl29n18    whfl30l06    whfl48e06    whfl49k16    whfl28n18    whfl46d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0654500 [Oryza sativa (japonica cultivar-group)] >gi|5007084|gb|AAD37809.1|AF155333_1 NADP-specific isocitrate dehydrogenase [Oryza sativa] >gi|20161528|dbj|BAB90451.1| putative NADP-specific isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|55773928|dbj|BAD72316.1| putative NADP-specific isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|113533280|dbj|BAF05663.1| Os01g0654500 [Oryza sativa (japonica cultivar-group)] >gi|125527107|gb|EAY75221.1| hypothetical protein OsI_03110 [Oryza sativa Indica Group] >gi|125571425|gb|EAZ12940.1| hypothetical protein OsJ_002765 [Oryza sativa (japonica cultivar-group)] >gi|169244431|gb|ACA50489.1| NADP-specific isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|215692671|dbj|BAG88091.1| unnamed protein product [Oryza sativa Japonica Group]
Score 819
Evalue 5.16137e-86
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1858
ctTCCCGTGCCACCACAGCCGCCGCCTCCCCCACCAACCTGCCCCGACCCGCTCCCGACCTCCGAGGCAAGCAGCGCCTCCGCCATGGCGTTCGAGAAGA
TCAAGGTCACCAACCCCATCGTCGAGATGGACGGCGATGAGATGACCAGAGTATTCTGGCAGTCTATCAAGGACAAGCTTATCTTCCCATTTTTGGACTT
GGACATTAAGTACTTTGACTTGGGAGTTCTACACCGCGATGCAACTGATGACAAGGTTACAGTGGAGGCTGCAGAGGCTACTCTCAAGTACAATGTGGCT
ATTAAATGTGCAACTATTACTCCAGATGAAGATCGGGTTAAGGAGTTCAACCTAAAACAAATGTGGAGGAGCCCAAATGGCACAATTAGGAACATTATAA
ACGGCACCGTGTTCAGAGAGCCAATTATATGCAAGAATGTCCCAAAGCTTGTTCCAGGATGGACTAAGCCCATCTGCATTGGAAGCCATGCTTTCGGTGA
TCAGTACAGAGCAACTGATGCCGTTCTCAAGGGACCTGGCAAACTCAGACTAGTTTTCGAGGgaaaagacga
page-top