Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1853
Contig Information
Length 642 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 15 Clones [Download: CSV  ,  FASTA ]
whfl42n10    whfl16o09    whfl37l06    whfl19c08    whfl6e04    whfl26h22    whfl10g18    whfl25n04    whfl16h17    whfl26g22    whfl52j18    whfl46f09    whfl49p08    whfl32o16    whfl26n04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Beta-galactosidase 7; Short=Lactase 7; Flags: Precursor >gi|46391137|gb|AAS90664.1| putative beta-galactosidase [Oryza sativa (japonica cultivar-group)] >gi|53981746|gb|AAV25023.1| putative beta-galactosidase [Oryza sativa (japonica cultivar-group)] >gi|125594319|gb|EAZ34378.1| hypothetical protein OsJ_017861 [Oryza sativa (japonica cultivar-group)]
Score 733
Evalue 6.39671e-76
Total Hit Count 261
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1853
ttgCAGGAGGG*TAGTATTTGAAACAGCCAAGATAAATGCACAACATGGTTTAAGAACAGCACAAGTAGTCCAGTATCTGAACAATGTTGATAGCTGGAA
AGTATTCAAAGAACCGATTCCTCTGGCAATAAACAAAAGCACACACATTGGAAATCGACTTTTTGAACACCTCTCAACTACAAAAGATGAGACAGATTAT
CTCTGGTACCTTACTAGATATGATTATAGATCAAATGGGGATACCCAGCTAGTGCTTAATGTGGAGTCACAAGCACATGTTTTACATGCTTACATCAACA
ATGATTATATAGGTAGTGTGCATGGGAGTCATGATGGACCAAGAAATATCGTTCTCAAGACACCTATTATGCTAAGGAAAGGACAAAACTCCATATCACT
GCTAAGTGTCATGGTTGGATCACCGGACTCTGGGGCGTACATGGAGCGAAGAATTTTTGGAGTTCGTAAAGTGAGCATACAACAGGGACATCAAAAATCA
CATTCTCTGAATAATGAGCTGTGGAAACACCAAGTTGGCTTATCTGGAGAAATGAATAATATATACACACGGGAAGGATCATCTCGTGCTCAATGGACTG
CCATCAATAAGTCCATGCACcttccacttatctggtacaaga
page-top