Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1849
Contig Information
Length 568 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 15 Clones [Download: CSV  ,  FASTA ]
whfl28b09    whfl31m12    whfl10b05    whfl53l20    whfl54f21    whfl24e14    whfl10b06    whfl19j14    whfl32m12    whfl35k10    whfl39p09    whfl39p10    whfl3p12    whfl52j10    whfl28b10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit J-domain protein [Triticum aestivum]
Score 481
Evalue 2.04137e-60
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1849
ctCACAAACCGATCCCGACCGGCGACATCGCTTCCACCGGATCAAGCAGCTAGGGTTTCGTCTTCTCCGCGGAGCTTGGAATTTTCGGCGAGATGTTCGG
GCGCGGGCCGCCGAAGAAGAGCGACAGCACGCGCTACTAC*GAGATCCTGGGCGTGCCCAAGGACGCGTCCCAGGACGACCTCAAGAAGGCCTACCGCAA
GGCCGCCATCAAGAACCACCCCGACAAGGGCGGCGACCCAG*AGAAGTTCAAGGAGCTAGCTCAGGCTTATGAGGTCCTGAGTGATCCTGAGAAGCGGGA
GATCTATGATCAATATGG*TGAGGATGCCCTCAAGGAGGGAATGGG*AGG*TGGAGGGATGCATGATCCGTTCGACATCTTCCAGTCATTCTTT**GGTG
GTGGTGGCAACCCCTTTGGA*GGTGGAGGGAGCAGCAGGGGCAGGCGGCAGCGCAGGGGtggagGATGTGGTCCATCCTCTGAAGGTTAGCCTTGAGGAG
TTGTACAATGGAACATCAAAGAAGCTATCTCTTGCCCGCAACGTGCTCTGCTCGAAGTgcaatggcaa
page-top