Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1845
Contig Information
Length 587 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 15 Clones [Download: CSV  ,  FASTA ]
whfl10h04    whfl41i11    whfl29k21    whfl6g10    whfl42f09    whfl53b12    whfl13d06    whfl39o13    whfl47b16    whfl10h15    whfl36k07    whfl42f10    whfl34c12    whfl35k07    whfl14i13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_019078 [Oryza sativa (japonica cultivar-group)]
Score 699
Evalue 4.49046e-72
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1845
ctCCTTCCCCAACCCAGAGCAAACCCCTCACCCGCACCCGCAGCGCCCTGCCCTCCCGAGGCCGCAGCCTTATCCTCTCCGCCCGCCTCCTCCACCCCGC
CCCGCTCCTCCAAGGAAAACATGGCTTCACCATTTGGTGCCACTTCTACCGTTGGGCTCATGGCAGCTCCATCTGGCATTGTATCAGACAAGAAGCCATT
TTCACTGTCATCTATCTCCCTTGCCGACAGGCCACGACATGTGCGCCTTCAGAGGAAATGCAACTTCAGGGTAAAAGCCGCCAAGGAGCTCTACTTCAAC
AAGGATGGCTCAGCCACCAAGAAGCTCCAGGTTGGAGTCAACAAGCTTGCAGATCTTGTTGGAGTTACCTTGGGACCAAAGGGAAGGAATGTTGTTTTGG
AGAGCAAGTACGGCTCCCCTAAGATTGTCAATGATGGTGTTACAGTTGCAAGAGAGGTTGAGCTGGAGGATCCTGTTGAAAATATTGGA*GCTAAGTTGG
TTAGGCAAGCTGCAGCGAAGACCAACGATTTAGCTGGAGACGGGACAACTACTTCTGTCGTCCTTGCTCAGGGGCTCATTGCTgagg
page-top