Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1842
Contig Information
Length 1079 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 15 Clones [Download: CSV  ,  FASTA ]
rwhfl32h14    rwhfl48j05    rwhfl10n05    rwhfl41a19    rwhfl10f08    rwhfl21d15    rwhfl10f19    rwhfl21c12    rwhfl21d16    rwhfl21c10    whfl48j05    whfl41a19    whfl10n05    whfl10f19    whfl10f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0500500 [Oryza sativa (japonica cultivar-group)] >gi|22165064|gb|AAM93681.1| putative ribosomal protein [Oryza sativa (japonica cultivar-group)] >gi|31432894|gb|AAP54470.1| ribosomal protein S18 containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639589|dbj|BAF26894.1| Os10g0500500 [Oryza sativa (japonica cultivar-group)]
Score 645
Evalue 2.6291e-65
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1842
aacGAGCATATGCTTATTATGTGTTCCGCACATTCTCTTTCAAAGGCGAACCTGAAAATGAGGATAACTGAGCACAAGGCATATCTCCTTCAGAACAAAG
AACAAAGTAACAGTTCGTCACAATATCCTTAAGTCGTCGGCCGCTGCATTTTTAGACATCTGCAGTTTGCAAATTGGGCGAGCTTGTAGAGGCGACAACG
CCCACACTGTTTACGCGGCCTCCACATCGGGCACGGCATCGGCATCGGCAACGGCATCTTCAGGCCCAGCATCCTTCTCGACGAAGTCCTACCCATACTC
CTCCTCTGAAGCATCCTCCTCTGCACTTCTGCCAAACATGAACGGCTTCTTGCCCATCGTCGTGAAAGGCATCAGTCCCAGCGCACGCGCTGTCTTAATC
TCCCTCGCAACCTTGCGCTGAGCTTTCGCGCTTATCTTGGTCTGATTCCTCTTGATGATAATGCCAGCTTCTGTAAGAAAGTTGGAGAGGAATCTAACAT
TCCTAAAATCGGCTTTCCTTAAAACCTCCTTTGTAGACGTTTCAAACTGAGGTCTTGGAGGATTCCTTGGGGCTGCAGGTCTTGTAAGGTCAAGATCCCG
G*ACATTGTAAGTCGAGCCACGCCTGTAATTCACATCCGGCCTGAAATCGTAGTCATCATCCTCAACCTCCTCCGTCATATGAAAGGTGCGGGCAGCGTC
GTCCAACTTCTCGTTCATGCCATCGTTCAAGGAATCAAAACCGTCCATGAACCCACCATTACTACTACGCTGACCAAACTCGGGCCGACCAAAAGCACCC
ATTCCAGAGCCGGTGCCGTGTCTTCCAAAGGAGCTCCCGACCCCATCGAGCTTCTCGAAGAATGACTTGTCATCTGACTCAAACAGACGTTTCTCAAAGT
CGTCCGCACTCTCCCCCGCGCCCTCTCCGGACAGGAAGGAGCGGCGGAACAAGGAGGCTGCGGCGGATGATGGGTCGGAAGTGAGCAGGCGTCGTGGAAG
AGATCGTCTCAGCGCCGAGCTCGCCATCTTGCTCAGTGCCTCGTCGCCGGCGCCGCAACCCGTCACCAGAGAAGCGAag
page-top