Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1835
Contig Information
Length 532 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 14 Clones [Download: CSV  ,  FASTA ]
whfl31n14    whfl3p16    whfl29e01    whfl40e02    whfl3p15    whfl4o20    whfl51e05    whfl5f12    whfl40e20    whfl10d09    whfl3n07    whfl26d11    whfl33m13    whfl34p07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0300200 [Oryza sativa (japonica cultivar-group)] >gi|14495217|dbj|BAB60936.1| putative ATP citrate lyase a-subunit [Oryza sativa Japonica Group] >gi|15623805|dbj|BAB67865.1| putative ATP citrate lyase a-subunit [Oryza sativa Japonica Group] >gi|113532348|dbj|BAF04731.1| Os01g0300200 [Oryza sativa (japonica cultivar-group)] >gi|125525538|gb|EAY73652.1| hypothetical protein OsI_01541 [Oryza sativa Indica Group] >gi|125570053|gb|EAZ11568.1| hypothetical protein OsJ_001393 [Oryza sativa (japonica cultivar-group)]
Score 660
Evalue 1.1484e-67
Total Hit Count 224
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1835
ggcTTCCCCGAGCGAGACCCAGATCAATCTCCGTCCCAGAGCAATTCTGCCTCCGCTTCGCCTTGCCCTGCCTCGCCTCGGAAGGGGAAGTAAATCATGG
CAACGGGTCAAATTTTCTCGAAAACCACCCAAGCATTATTCTATAATTATAAGCAACTCCCTATCCAACGGATGCTTGATTTTGACTTCCTCTGTGGGAG
AGAAACACCTTCTGTTGCTGGAATAATCAATCCTGGTTCTGATGGGTTCCAGAAACTTTTCTTTGGACAAGAAGAAATTGCTATTCCGGTTCATCCTACA
ATTGAAGCTGCTTGCAATGCACACCCAACCGCGGATGTATTTATCAACTTTGCATCTTTCCGGAGTGCGGCTGCTTCTTCAATGTCAGCTTTGAAGCAGC
CAACTGTCCGAGTTGTAGCCATTATA*GCAGAGGGTGTTCCTGAATCAGACGCAAAGCAGCTAATTAGCTATGCACGTGCTAACAACAAGGTCATCATTG
GACCTGCAACAGTCGGaggagttcaagctggt
page-top