Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig820
Contig Information
Length 443 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whhg7g02    whhg8j01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0567300 [Oryza sativa (japonica cultivar-group)] >gi|52077207|dbj|BAD46251.1| putative monodehydroascorbate reductase [Oryza sativa Japonica Group] >gi|113632193|dbj|BAF25874.1| Os09g0567300 [Oryza sativa (japonica cultivar-group)]
Score 594
Evalue 3.8979e-60
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig820
TCCTCCCTCTCCTCTGCTCTTCCGTTTCCTCCTCGCAATCCATCCATCGATCCGTCGGGGAGATGGCGTCCGAGAAGCACTTCAAGTACGTCATCCTCGG
CGGTGGCGTCGCGGCGGGATACGCCGCGAGGGAGTTCGGCAAGCAGGGCGTCCAGCCCGGGGAGCTCGCCATCATCTCCAAGGAATCCGTGGCTCCGTAT
GAGCGCCCTGCGCTCAGCAAGGGCTACCTCTTTCCCCAGAATGCCGCCAGGCTTCCAGGATTCCACACCTGCGTCGGGAGCGGCGGGGAGAAGCTCTTGC
CCGAATGGTACACGGAAAAAGGCATTGAGCTGATCCTGAGCATGGAAATTGTCAAGGCTGATCTTGCCTCCAAGACATTGACCAGTGCAGATGGAGCAAC
CTTCACCTATGAGACCTTGCTCATCGCCACTGGCTCCTCGACC
page-top