Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1808
Contig Information
Length 736 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 14 Clones [Download: CSV  ,  FASTA ]
rwhfl10d02    whfl3m05    whfl40h03    whfl28f18    rwhfl28f18    whfl10d02    whfl15l20    whfl37a21    whfl37a09    rwhfl40h03    rwhfl5i21    rwhfl3m05    rwhfl15l20    rwhfl21b01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01213 [Oryza sativa Indica Group]
Score 198
Evalue 5.05054e-19
Total Hit Count 32
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1808
accggaATGACATTTTCCGGTGGAAACGCTAGCTATCCCTTCCCTTCTGGGCTTGCCCCAAATAACCTCCTTTTCGCCGCGCCGCCCGGCTCACCCGTTC
CGAATCCAGCAGAAGTGCAGAACCCCAGCGCGGCCGAGAGCAGGG*CAGTCCTCC*GCTGCGCCACTTCGAAGGCTTCCATCTCCGTCCGGGGTGGGCTG
CGCAGAAGTAGACAGATTGATCGAGGCTCATCTCCTCTCTCGACATGGACATGGATGCATCATTTCGTTCAGCAATCGTCAATGGAGAGACTCTCAAGAT
GTTTGTTGGGCAAAGAGTGCGTACAGTACTTAAGTTCCAACACACTCAAGGTGGAGTTCTTGTTGGGCAGTCGACTGATGGACATCAGTTGACCATCAGA
GGTGCCTCGGAAGGCCGTGAATCACATTTATCTAGAGGTTATTGGGATTGCTGACAACGACCAGTCCATCAGTGCTGAAACTTGCAAAGATTTTGATGAC
AACTTTGATGCTGATGCGTTCAATGGGCTGTGCAAGCTTGTGGTGAACGGCAAGGTGAAAGAAGTTCTCCTGTAGAGGAGCTCATTTGCGAGATCAAGCT
TACTATGAAGACAGTTTGCGTTGTGTGTGTCTCCCGGAGTCGATGAGCTTATTACTGCTTCCGCTTGTAGTAACCACTACTAGTTAGCAATGCAAAGCAA
ACCTTAGGTTTATGTTATCGTCGCTTGGATTTAAat
page-top