Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1807
Contig Information
Length 675 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 14 Clones [Download: CSV  ,  FASTA ]
rwhfl9h19    rwhfl34c08    rwhfl48i24    rwhfl10g07    rwhfl24e15    rwhfl26e15    rwhfl25e15    whfl24e15    whfl25e15    whfl9h19    whfl48i24    whfl34c08    whfl10g07    whfl26e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain 4, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390381|pdb|2J37|4 Chain 4, Model Of Mammalian Srp Bound To 80s Rncs
Score 517
Evalue 7.84818e-51
Total Hit Count 447
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1807
cctTCGATTGCATCAAATTCATGAAAGTGTGCGGCGATATGGTA*GGCAATGGAGCCACCGAGCCCCTTTGCTAAGTAACAACTACAAAATTCCAATAAC
ATAAGAAACCACGACACAAGCGCCTACTGCAGGACCCTCCCTCTGACTTATATGATGCCGATCTTGTTGGCCACATCAAGAGCATCGTAGTCTGGTGTCA
GCTTCACGTACGCCTTCTTCTTGCCATCAGGCCTGATGAGGGTGTTAACCTTCTTGGCCTGAATGTCGTACATTTTCTTGACAGCGGCCTTAATCTTCTT
CTTGTCGGCCTTCAGGTCGACGATGAAGACGAGTGTGTTGTTGTCCTCGATCTTCTTCATTGCAGACTCAGTGGTAAGCGGGTACTTGAGGATCTGATAT
TGATCGAGCTTGTTCCTCCCAGGGGTGCTGATCCTGGGGTACTTGGGGTCCCTGGCCTTGGACAGGGTCTTGGGGCGGTGAAATGTCACAG*AAGTGCGG
ATCTTCTTTGCCGTCTTCTTGATTGACCCAGACTTCACAGCCTTGGCAACCTTGGCGGCCTGGGCCTTGGCATCGCCCTTCTTGGCAACAGCAACTTTGG
GAGCCATTTGAGCTTCTCAGGACAGCCCTTGAACTTCCTGGGGTGCGGGCGCGAGGCGATGCGAAGACGGCTGag
page-top