Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1801
Contig Information
Length 701 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 14 Clones [Download: CSV  ,  FASTA ]
rwhfl42e18    rwhfl10a05    rwhfl10a06    rwhfl29n14    rwhfl24o21    whfl10a06    rwhfl28n14    rwhfl24o10    whfl10a05    whfl24o21    whfl24o10    whfl42e18    whfl28n14    whfl29n14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit fiber protein Fb15 [Zea mays]
Score 330
Evalue 4.03469e-29
Total Hit Count 15
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1801
ttatgtaccataaaaggcatcacaagaatgcaaaaccatcgacacaaaatcgatgggagtatactgcgaagaacttgtacTCGATTCGCTGAAAATGTTT
TTAATCACAATGCATGCACTTCCAGTTTG*AAGTTGCTTATGACAGGACACGG*AGGAACATAACAGTGGACTAGACAGTCCGTTGCTGCCTTCCGACAC
AAAATAAACCAGCCATCAAATAGACATCAACTCC*AGGTAGCCCATCAGTAGAAGAAAAA*TGGAGAACACCATCCTGAA*TCAACCGTAGATAAGCTCT
CCTGCGCGAGGCGGATCCGGATCTAGTGGCCGCCGTGCTTCTCGAGGTGCTCGAGGTGGCGGCGCTCCTGGGGCAGGCCCACGAGGTA*C*GAGAAGGCC
ATGCCGCCGAAGCA*GATGTGGAAGAGCGGGTCAGCCGAGCTGG*TCTCGATGTACTTCTC*GATGTAGCGGTCCACCGCCTGGTCGGTGCTCTTCTTCA
CGTTCGCCCAGGTGAGGCGCGGCTTGAGGTACGCCGGCACCTCGCGCACCTTCATCGCGCGGATCTCGTTGTACAGCGCACGCATCGCCATGGCCGCGAC
CTTGGAGATCTCCCTCTCTCTCTCCTCGTGCGCTCGG*AGTCTAGGGTTCGTTTGGTCGTTGGCTTCGGTGGGGaggggaggatggaatggcacaggagg
t
page-top