Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig18
Contig Information
Length 517 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl1l07    whfl50e16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NADP-dependent oxidoreductase P1 [Zea mays]
Score 358
Evalue 9.348e-52
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig18
atCAAAACCAATTCAACTCCCTCAGATCCTAGTCTTGCAGTCCACCCACGGCGGCGATGGCGGAGCTCAAGAGCCGGCGGGTGATCCTCAAGGACTACGT
GGAGGGCTACCCCACGGAGGCGCACATGGAGCTGCTCCCCGCCGCGCCCGTCGACGAGGCCGAGGAGGGCTCGGTGCTGGTCAAGAACCTCTACCTCTCC
TGCGACCCCTACATGCGCCCCAAGATGTCCCGCCCGCTGCACCAGTCCTACACCGCCGCCTTCGTCCCGGGCGCCGCCATCACCGGTTACGGCGTGTCCC
AGGTCGTCCGCTCCTCGCGCCCCGGGCTCGCCGCCGGCGACCTCGTCTGGGGCATGACcgggctGGGAGGACTACAGCGTCATCAAGCCGCCCTTCACGG
CCATACTCACCAAGATCcagcccgacgacggcgtgccgctgtcctactacaccggcatcctcggcatgccggggctcacggcctacgtgggattccacca
catctgctcccccaagg
page-top