Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2393
Contig Information
Length 2746 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 42 Clones [Download: CSV  ,  FASTA ]
whgc10b05    whgc10m24    whgc10p20    whgc1f11    whgc4m11    whgc6e20    whgc6l10    whgc6m05    whgc8h01    whgc8l19    whgc9k22    whgc13g21    whgc14p18    whgc15p18    whgc16h13    whgc17e12    whgc17f20    whgc17k20    whgc18a24    whgc18i23    whgc18n24    whgc3e08    whgc3g12    rwhgc10m24    rwhgc10p20    rwhgc1f11    rwhgc4m11    rwhgc6e20    rwhgc6l10    rwhgc8h01    rwhgc9k22    rwhgc13g21    rwhgc14p18    rwhgc16h13    rwhgc17e12    rwhgc17f20    rwhgc17k20    rwhgc18a24    rwhgc18i23    rwhgc18n24    rwhgc3i24    rwhgc3k20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_012477 [Oryza sativa (japonica cultivar-group)]
Score 470
Evalue 1.703e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2393
TGTTGCCGATAACAGAGAGTAGCATTGCACCATAATCCAAAACTTGACAGCAAACAGAGACTTCCACAAGTAGCACAATTCAAAGACACCTGGTTCTCGA
CTATAATAAAGGGAAGTGCAACAGACAGCTCCCAGCTAGTAAAAACCCTTTTATGGCAACATCCTAAGCTTCTACCTTCTCGGCTGGTGCATCAAGCATC
AGGGCCTTGGTCGGCTTCGCCAAGATGTCGGTGAACTCCTGGTACGGCGCCTTGGTGAAGGTTGTCTCCCTCCAGAAGTCAGGGGTGAGGAATCCATAGG
TCTTCATCAGGCAGTCGAAGGTTGCCTTGACGAAGTTGCCAAGGGTCTTGGTGGATCCACGCGAGGAAGTGAAGACATCATCAATCCCGGCGAACTGCAG
GACCTTCTTGGGGACGCGGGCGGCGACGATTCCGGAACCCCTGGGGGCGGGCACCATGCGCACGCCCGGGCATTGAGAAGGAAGGACGCTTTCAGAGGCG
AAAGGCCATGGGGAGAGATTTTTCTGTGATCCATGGATCTCCGATCGGGAAACCGTATCCAAGCTCCGTGGCTAGTCTGCGCTCTTTGGACTTTTCAAAC
TTAGCGAACTGAAACATCTGAGTAGCTAAAGGAAGGAAAATCAACCGAGACCCCGTTAGTAGCGGCGAGCGAGAGCGGAACAAGGGTTTTCATCAAAAGA
AATCCGAAGCGGTTTCATTCGATTTGTTGTGGATTGGATGATGGAAAAACCAGCAAGCAGCAAGCGTAGTTAGAAAAGTTGCCGTAGCGCGCCCTACGGA
GTTGTACAAAGTCAGCAACCGTTTTGGGGCGCAAGCATAGGCAACACAGGACTGATGACGGGGTGGGGCGCGCAGTGAACTGGTTTTCTAAAAAGATTGG
AAGATCCGGCCAAAGAAGGTGATAGCCCTGTTCATTCGTTCCCATGGTTCGATCCTTCCCAGTAAAACGCGGCGTGTTCGAATGATGATCGCTTTTACGC
GAGAAAGGGGGACCACCCTCTAAGCCTAAGTATTCCTCAATGACCGATAGCGTACAAGTACCGTGAGGGAAAGGTGAAAAGAACCCCAATCGGGGAGTGC
AATAGAGAACCTGAGATCCGATGCGAACAATCAGTCGAAGGAGCGGAGCGCGGGCGCACTCACTCTAACGGCGTACCTTTCGCATGATGGGTCAGCGAGG
AAATGGGAACAGCGGCTTAAGCCATTAGGTGTAGGCGCTTTCCAGAGGTGGAAGATTTACGTTCTTCCTATTTGACCCGAAACCGATCGATCTAGCCATG
AGCAGGTTGAAGAGAGCTCTAACAGGCCTTGGAGGACCGAACCCACGTATGTGGCAAAATACGGGGATGACTTGTGGCTAGGGGTGAAAGGCCAACCAAG
ATCGGATATAGCTGGTTTTCCGCGAAATCTATTTCAGTAGAGCGTATGATGTCGATGGCCCGAGGTAGAGCACTCAATGGGCTAGGGTGGCCCCCATTTC
GCTTTACCAACCCCAGGGAAACTCCGAATACAGGCCGTCATCCTTAGTACAGACAGACTGATTGGGTGCTAAGATCCAAAGTCGAGAGGGAAACAGCCCA
GATCGTACGCTAAGGTCCCTAAGCAATCACTTAGTGGAAAAGGAAGTGATCGAGCGATGACAACCAGGAGGTGGGCTTGGAAGCAGCCATCCTTTGAAGA
AAGCGTAATAGCTCACTGGTCTAGCTCCATGGCACCGAAAATGTCTCAGGGCTCAAGTGATTCACCGAAGCGACGAGACCTTGAAAGCAGCTTTTTCAAG
TGTCAGTAGCGGGACGTTCTGTCAATCGGGGAAGGTTTTTGGTGACAAGACCTGGAGATATCAGAAGTGAGAATGCTGACATGAGTAACGAGAAATCCTG
TGAAAAACACGATCGCCTGCCAGTGGAAGGCTTTCTGCGTTCAGTCAATCTACGCAGAGTGAATCGGTCCCTAAGGAACCCCCGAAAGGGCTGCCGTCAT
AGTCAAAATCTGAGTTTGATCCTGGCTCAGAAGGAACGCTAGCTATATGCTTAACACATGCAAGTCGAACGTTGTTTTCGGGGAGCTGGGCAGAAGGAAA
AGAGGCTCCTAGCTAAAGTTGTCTCGCCCTGCTTCAAAACTACAGGGCGCGCGCTACGGCTTTGACCTAACGGCCTCCGTTTGCTGGAATCGGAATAGTT
GAGAACAAAGTGGCGAACGGGTGCGTAACGCGTGGGAATCTGCCGAACAGTTCGGGCCAAATCCTGAAGAAAGCTCAAAAGCGCTGTTTGATGAGCCTGC
GTAGTATTAGGTAGTTGGTCAGGTAAAGGCTGACCAAGCCAATGATGCTTAGCTGGTCTTTTCGGATGATCAGCCACACTGGGACTGAGACACGGCCCGG
ACTCCCACGGGGGGCAGCAGTGGGGAATCTTGGACAATGGGCGAAAGCCCGATCCAGCAATATCGCGTGAGTGAAGAAGGGCAATGCCGCTTGTAAAGCT
CTTTCGTCGAGTGCGCGATCATGACAGGACTCGAGGAAGAAGCCCCGGCTAACTCCGTGCCAGCAGCCGCGGTAAGACGGGGGGGGCAAGTGTTCTTCGG
AATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAAGTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAG
ACAGAGGAGAGTGGAATTTCGTGTGTAGGGGTGAAATCCGTAGATC
page-top