Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2378
Contig Information
Length 780 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 20 Clones [Download: CSV  ,  FASTA ]
whgc10c20    whgc11i20    whgc1a10    whgc6n17    whgc6o19    whgc7n17    whgc8m06    whgc9f03    whgc9f04    whgc9n24    whgc17a11    rwhgc10c20    rwhgc11i20    rwhgc1a10    rwhgc6o19    rwhgc7n17    rwhgc9f03    rwhgc9f04    rwhgc9n24    rwhgc17a11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit salt tolerant protein [Triticum aestivum]
Score 679
Evalue 1.7557e-69
Total Hit Count 477
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2378
CACTTCACTGATCAAGTAGCTGGCAAGAGCTTTGAGCGCGTTGCAACTTTGCATCCCGGTCGATCGATGGCGTCCAAGGTCGAGCTGGTGGTGGAGGTGA
AGTCGCCGGCGGAGAAGCTGTGGACGGCGATGCGCGAGTCGACGGAGCTGTTCCCCAAGATCTTCCCCGAGCAGTACAAGAGCATCGAGACCGTGGAGGG
CGACGGCAAGTCCGCCGGCACCGTCCGCCTCATCAAGTACACCGAGGGGGTTCCGATGGTGACGTTCGCCAAGGAGAAGGTGGAGGTGGCGGACGACGAG
AAGAAGGTGGTGTCGTACAGCGTGGTGGACGGCGAGCTGGTCAGCTTCTACAAGAACTTCAGGGTGACGGTGCAGGTGACCGACAAGGGCGCCGACGGCG
GCGGCGCGGTGGTGAACTGGACCATGGACTTCGACAAGGCCAGCGACGAGGTGCCCGAGCCGGACGTCATCAAGGAGACCGCCGCCAAGACCCTCCACGA
CCTTGACGACTACCTTCTCAAGAACTAGAGTAGCTTTTACTAGCTGCCTCGTCGCTGGCCGCCGCGTCCGTCGTCCGTCCATCCATCCATCCATGTCTAC
TGTCATCGTTACTTGCTGTCTGCCGTGTTCCCCCATCTAGCTTACTCTCACGAAAACGACCGTGTGTACCATGTACGTGTGCATCTGCCTGCGCTGGGAC
GGACGCGTGAGTAGTAGTGGACTGATAATAAAGTCCCAACTTTATGGTCACGTATACGTAGCGAATTGGTGTTAGATTTG
page-top