Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2376
Contig Information
Length 1075 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 19 Clones [Download: CSV  ,  FASTA ]
whgc10a07    whgc1g11    whgc7h20    whgc14i19    whgc16d03    whgc17i06    whgc18c20    rwhgc10a07    rwhgc11i15    rwhgc1g11    rwhgc1o22    rwhgc2a14    rwhgc7h20    rwhgc14i19    rwhgc15l16    rwhgc16d03    rwhgc16p04    rwhgc17i06    rwhgc18c20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phosphoethanolamine methyltransferase [Triticum aestivum]
Score 1508
Evalue 2.22477e-165
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2376
TTTTTTTTTTAGCAACAGAATAGCACGTTACAAAGGCGAGTCTCGCTCGTCACAGTACAAGTTCAGGAATACAATACGTACGTACACATTATCTTATCTT
ACAGATCCGGGTGCCCGGCCAGTGCAGCCAGGCACCGATCCTCTTTATTTATTCTTAATAACAGAAGCGGCTCTGCTTCCGGATCATCGCGTCCACGGCG
TCGCTGCTCGGCGGCCAGATCACTTGGTCGCGATGAACAGCCCCCACTTCTGCTCGCCGGCAGAGCTCCGCTTCAGCTTCGCGCTCCAGCCGTTGACGAT
GTCGTCGTAGTCCTCCTGGGTGAAGTCCGCCAGGAAGGCCTCCTTGTTCTTCTCGGTCTCGCCCAGCTCCCTCTCCAGGACCCTCAGGAACTGGTCGGTG
CGGTCCTCAGCGACGACATCATGGAAACCGGCATCCTCAAGCATCTTTCCGTAGGTCTTCACATCATGGAGGTCATAGCCTCTCTGCTTGATGTACGCAG
CGAATTCCTCTGATGGTGTCCCAGGGCTCCTGCAGTAGTCACTGATCAGCACTTTGCCCCCAGGCTTGAGCCACTTGAAGAAGTTTCTGAACAGAGCAGG
TTTGTCTTGAATGTGGAGGATGGTGTCACGGCTGTAGATGACATCAAACGTGTTCTCTGCGTATTCCTTGGTGGTGCAGTCAGCAACCTCAAACTCAACG
GAGCACGAGCGCCCGATGGCACGCTCAATTGCGAACGAAACCATGTTGATAGAAAGATCGATGCCGAGGACATGGACATCATAGGTTTCAGCCATGTAGA
AGTCGCCTCCTCCGATACCACACCCTACATCGAGCACCTTCTGGCCAGCTTTCAGGTCCAGCTTGTCCACAAACTCCTTTGTGGTCTCGAATCCACCGGT
GCTAACATAACCCTCCCCAAACACGCGCTCATAACGCAAGATTCCAGTGGATTTGTACTGCACATTGTCCAGGAATCTCTGAAAGCCTTTGTCTTCTGTG
CACTTGACCTTCTCCCACAGCCAACATATCTGGTTCTGGTTCTTCTTGCTTTTCACATAAGCTCCAATGCACTGC
page-top