Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2369
Contig Information
Length 1122 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 16 Clones [Download: CSV  ,  FASTA ]
whgc10a17    whgc5k18    whgc5l05    whgc5l06    whgc5m22    whgc5m24    whgc5n11    whgc7n22    rwhgc10a17    rwhgc5k18    rwhgc5l05    rwhgc5l06    rwhgc5m22    rwhgc5m24    rwhgc5n11    rwhgc7n22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 1501
Evalue 1.53949e-164
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2369
TTTTTTTTTTAATTTGAAAACGTAACGTAACAAACTCAAGACTTAGATGATGAACAATTCGCCACTCAGTTTACAATACACACCGACAACCGCCTCAAAA
ACCACCAAATCAAAGGGATGAGCACATGGCGCCGCGCCGCGCCGAGAAACAAACTAGCCTAACCAACAGGTGGATACAGAGACCCAGATTATTCAAAGTA
AACACGGCTATGGTGGCGACATCCTCCTTGCAATTAAAATGGGGGAGCTGCTATACGGCTTACTGCGCCTTGGCGAGCTCGGCGCGGATCTGCTTGGCGG
CCTCGACCATGTTGGTGAGGGCGGGCTTGACCTCGGCATACTTGCGGGTCTTGAGACCGCAGTCGGGGTTCACCCACAGGATGTTGGTGTCGAGCACCGC
GAGCATCTTGTTGACACGGTCGGCGATCTCCTCCTTGGACGGGATCCTGGGGGAGTGGATGTCGTACACGCCCGGGCCAATGCCGGCGCCGTACACCACG
CCCTCGCGGAAGACGGAGAGAAGCTTCTCGTCGGACCGCGAGTTCTCGATGGTGATCACATCGGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGA
AGTTGGAGTAGCACATGTGGGTGTGGATCTGGGTGGTGTCCTGGACACCGCAGTTGGTGATCCTGAAGGAGTGCACGGCCCAGTCCAAGTAGAAAGCATG
CTCCGACTTGCGGAGTGGCAGACCCTCTCTCAAAGCAGCCTCATCGATTTGGATAACCTGAATACCACCAGCCTCAAGGTCCTCGACCTCCTTCTTGATT
GCAAGAGCAATCTGGTAGCAAGTCTCAAACCTCGGTTGGTCATTTCTGACAAAAGACCAGTTAAGGATTGTGACAGGGCCTGTCAGCATACCCTTCATTG
GGCGAGCAGTCATGCTCTGCGCCATCTTGGACCAGAAGACGGTCATGGGGTTGGGGCGGCTCACATCACCATAGATGATCGGTGGCTTGACGCACCTTGA
TCCGTAAGATTGCACCCAACCATTGGCAGTGAACGTGAAACCAGAGAGCTGCTCACCGAAGTACTCAACCATATCGTTCCTCTCAGGCTCTCCGTGCACA
AGCACATCAATGTCAAGCTCTT
page-top