Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2367
Contig Information
Length 804 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 15 Clones [Download: CSV  ,  FASTA ]
whgc10a01    whgc11d22    whgc2b07    whgc6b09    whgc7n19    whgc8b20    whgc17b12    rwhgc10a01    rwhgc11d22    rwhgc2b07    rwhgc6b09    rwhgc7f15    rwhgc7n19    rwhgc8b20    rwhgc17b12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit salt tolerant protein [Triticum aestivum]
Score 689
Evalue 1.27631e-70
Total Hit Count 479
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2367
AGATCGAATCAGACCAAATCGCACAAATCTAACACCATTCGTACGTATACGTGATCATAAAGCTGCGACTTTATTATCATTATTATTATTCCACTACTCA
CGCGGCCGTCCCATCGCACACGTACACGGCCGTACACACGGTCGTTTACGTGAGAGTAAGCTTGGTGCGGGGACACCGCAGAGAACAGGCAACGACGACA
GTATTCATGGACGGACGGACGGACGGACGGACAGACGGAGGGTCGTCCGCGGCGGCCACCCTGGCGACGAGGCAGCTAAAAGCTGCTAGTTCTTGAGGAG
GTAGTCGTCGAGGTCGTGGAAGGTCTTGGCGGCGGTCTCCTTGATGACGTCCGGCTCGGGCACCTCGTCGCTGGCCTTGTCGAAGTCCATGGTCCAGTTC
ACCACCGCGCCGGCGCCGTCGGCGCCCTTGTCGGTCACCTGCACCGTCACCCTGAAGTTCTTGTAGAAGCTCACCAGCTCGCCGTCCACCACGCTGTACG
ACACCACCTTCTTCTCGTCGTCCGCCACCTCCACCTTCTCCTTGGCGAACGTCACCATCGGAACCCCCTCGGTGTACTTGATGAGGCGGACGGTGCCGGC
GGACTTGCCGTCGCCCTCCACGGTCTCGATGCTCTTGTACTGCTCGGGGAAGATCTTGGGGAACAGCTCCGTCGACTCGCGCATCGCCGTCCACAGCTTC
TCCGCCGGCGACTTCACCTCCACCACCAGCTCGACCTTGGACGCCATCGATCGACCGGGATGCAAGGTTGTACTGCGGTCAAACCTCTTGCCACTACTTG
ATCA
page-top