Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2362
Contig Information
Length 1084 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 14 Clones [Download: CSV  ,  FASTA ]
whgc2b20    whgc5a06    whgc7g24    whgc8c20    whgc14p20    whgc15f13    whgc20k01    rwhgc2b20    rwhgc5a06    rwhgc7g24    rwhgc8c20    rwhgc14p20    rwhgc15f13    rwhgc20k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1094
Evalue 2.28644e-117
Total Hit Count 497
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2362
TTTTTTTTTTCAAACATAAAACACACACGGCAGGAATAAACTAAATATTTAGTTTTAAACTCATAACCTCCATCCAGAAAGTAACACGAACAAAATAAGA
TAACTGAACGCTGGCTAGGAATGTCGACAGAAGTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAGGTGGCACATATATCATC
TTCTAGATATGAAGCAGCAAAATAGCGACTTCTATTTTCTACTCAGCAGCAGCAACCTCCTCCGCTCCAGGAATCACCTCATCTCCATCAGCAGGCCTGT
CAAGCTTCACACCAACATCCTCCTTGTAGTCACCGTGCACCTCCATGAGCTTCCCCAGGTCAAACTTGGGGGCCTTCAGGATCTTCACCTTGCGGACGTA
CACGTTCTGGAGGGGGAAGATGCTTGAGGTGGCCTTCTCAATCTCCTTTCCAATCACCTCAGGGATGAACTTGTTCACAAGCTCCTTCAAGTCACAGCTT
GCAGCTTGGTTGACCATGATCTCAACCATCTTGCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCACCTGGTTTGGGCGTCTCT
TCGTGAAGCCAATGGTGAACATGCGGAGCATGTAGTTGTCAGTGGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCACTTCCTCACAAGAGACCT
GAGCTTGTCAGTGGTGAAGTCCATGCCCCAGAAGTTTGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCTTCCTGTAGGCCTGGTCC
TCATCGTTCTGAAGATCAGCTAGAGATACTTCGAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGCGTCCTGGACACGAGGGTCTTGC
CGACGTTGCGGCTGGTGAACAGCAGCGGCGCCTTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTTTTGCTACCCTTCCTCCCCTN
GGAGATGCGCTTGTTCTTGCCGACCGCCATGGTTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTTGAGCGTC
page-top