Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2359
Contig Information
Length 816 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 14 Clones [Download: CSV  ,  FASTA ]
whgc10e13    whgc10m14    whgc8b16    whgc12d23    whgc15b11    whgc15l21    whgc15p16    whgc18e04    rwhgc10e13    rwhgc10m14    rwhgc8b16    rwhgc15b11    rwhgc15p16    rwhgc18e04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 928
Evalue 2.54099e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2359
TCCTAGCAAGCTATATACCTACATAGTACAGCCATGGCCCCCACCGTGATGGCCTCGTCGGCCACCTCCGTCGCTCCTTTCCAGGGGCTCAAGTCCACCG
CCGGCCTCCCCGTCAGCCGCCGCTCCAACGGCGCTAGCCTCGGCAGCGTCAGCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCCATCGAGGGCAT
CAAGAAGTTCGAGACCCTGTCTTACCTGCCACCGCTCAGCACGGAGGCCCTCCTCAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCTTGCCTC
GAGTTCAGCAAGGTTGGGTTCATCTTCCGTGAGCACAACGCATCTCCTGGGTACTACGATGGCCGGTATTGGACAATGTGGAAGCTGCCTATGTTCGGGT
GCACTGACGCCACACAGGTGATCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCGTATGTCCGCATCATCGGATTCGACAACATGCGTCAGGT
GCAGTGCGTCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACGACAGGCCATATATAAAGTGCCATTG
CAGTTTTGTCAACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTTATCTTTCTTATTTGTTCCTAAGAATATGTGTATGTCCATGTTCATGTACGAACA
TGGCTCGAGAAAGCATGCTCGTATGTGAATGCTATCGGTGGCTATGTATATGCACGGACGCATAATATTATACAATATGTCGACTATATACGTTTTAATG
GTAACCAAAAAAAAAA
page-top