Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2349
Contig Information
Length 866 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 13 Clones [Download: CSV  ,  FASTA ]
whgc10e20    whgc10f23    whgc11b02    whgc4g11    whgc8g07    whgc15b21    whgc17b19    rwhgc10e20    rwhgc10f23    rwhgc11b02    rwhgc4g11    rwhgc15b21    rwhgc17b19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit eukaryotic translation initiation factor 5A1 [Triticum aestivum] >gi|78191541|gb|ABB29983.1| translation initiation factor 5A [Dasypyrum breviaristatum] >gi|78191543|gb|ABB29984.1| translation initiation factor 5A [Secale cereale] >gi|78191547|gb|ABB29986.1| translation initiation factor 5A [Aegilops tauschii]
Score 845
Evalue 1.17991e-88
Total Hit Count 451
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2349
CTAGCCTCCGGATCCATCCATCCGCCCCTCGCTGCCGCTGCGTCTCGTCTCCACCACCCCACTTGCCCCCGGACTCAGGAGGATCGTCGGAGATGTCGGA
CACCGATGAGCACCACTTCGAGTCCAAGGCCGACTCCGGCGCCTCCAAGACCTACCCGCAGCAGGCCGGCGCCATCCGCAAGGGTGGACACATCGTCATC
AAGGCCCGTCCCTGCAAGGTTGTTGAGGTCTCCACCTCCAAGACTGGGAAGCATGGTCACGCAAAGTGTCACTTTGTTGCCATTGACATCTTTAATGGAA
AGAAGCTTGAGGATATCGTTCCTTCATCCCACAACTGTGACGTCCCCCATGTTGACCGCCAAGATTATCAGCTGATTGACATAACTGATGATGGATATGT
CAGCCTTCTAACTGAGAGTGGCAACACGAAGGATGACCTGAAGCTTCCCACTGATGATGTTCTGCTTGGCCAGATCAAGACTGGATTTGCTGATGGCAAG
GACCTGATCCTGTCTGTGATGTCCGCCATGGGTGAAGAACAGATCTGCGCTGTGAAGGAAATCGGTGGTGGCAAGTAAGCAGCTGTGCGTGGTTGCCTAC
CTGCGATACTTGGTATCTAGTGCTTCTGGGTGTTTGAGATACACATACATAGGCATCAAGATATCTGTTGGGTGAAACAAGTTTGATCCAGATTTGTGTG
TTCTTTACACCGAATGCTCGAGGTGCTGCTAGTACTTTGTTATCTATCTATCTATCTCTATTATAATACCCTTTGGAATTGGAACTGAGTGGTGGCTGGA
ACTTAGATTCCGGTTTGCTCATCCGCCCTATCTCTATGAATGAATTGGTTTGGGTTAAAAAAAAAA
page-top