Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2347
Contig Information
Length 1482 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 12 Clones [Download: CSV  ,  FASTA ]
whgc10d09    whgc10m15    whgc6f06    whgc15m03    whgc17j24    whgc17k24    rwhgc10d09    rwhgc10m15    rwhgc6f06    rwhgc15m03    rwhgc17j24    rwhgc17k24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0654500 [Oryza sativa (japonica cultivar-group)] >gi|5007084|gb|AAD37809.1|AF155333_1 NADP-specific isocitrate dehydrogenase [Oryza sativa] >gi|20161528|dbj|BAB90451.1| putative NADP-specific isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|55773928|dbj|BAD72316.1| putative NADP-specific isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|113533280|dbj|BAF05663.1| Os01g0654500 [Oryza sativa (japonica cultivar-group)] >gi|125527107|gb|EAY75221.1| hypothetical protein OsI_03110 [Oryza sativa Indica Group] >gi|125571425|gb|EAZ12940.1| hypothetical protein OsJ_002765 [Oryza sativa (japonica cultivar-group)] >gi|169244431|gb|ACA50489.1| NADP-specific isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|215692671|dbj|BAG88091.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2022
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2347
CCCACTTACATAACATCAGCATCTACAGAATCACTTGCATGTTTGACAATAATATGCGATGGTGCAGTAAAAGCTCGTTCTGTTCAGGACGAAAGCATGA
CAGATAATGGCGACATAACCAAAATGACTTGAATCGATGAGTAATGACTATTCGAGCATTGAAGTGGAAGAGGTCTTTCACAGTCTTGATTTGAGCTCAG
CAGCAACAGCGTCAATGAACTCTTCAGTGTTCAGGTAATCGCTTCTTGTAACTTTTGAGGATCCATGGACAAGGAGTGCAAGGTCCTTGGTCATCTTCCC
AGACTCCACAGTTCCGACGCACGCTTCCTCAAGTTTCTGTGCAAATTCAAGAAGTCTAGCATTCTCGTCTAGCTTTGCCCTGTGTGCAAGTCCTCTTGTC
CAAGCAAAGATTGAAGCAATGCTGTTTGTGCTGGTTTCACCACCTTTCTGGTGAACACGGAAATGGCGGGTAACTGTGCCATGGGCAGCTTCAGCTTCGA
TGGTTTTACCATCAGGGCACATCAATACTGACGTCATCAAGCCCAAAGAGCCAAAACCTTGAGCTAAGAAATCACTCTGCACATCTCCGTCATAGTTCTT
GCAAGCCCAAACATAGCCTCCTTCGCTCTTAAGTGCATAGGCAACCATGTCATCAATGAGACGATGTTCATACCATATTCCAGCAGCCTCATATTTGGAT
TTCCAGCCAGCTTCATAGATCTCCTGGAAAATGTCCTTGAACCTGCCATCATATTTCTTAAGGATTGTGTTTTTTGTGCTAAGGTACAATGGCCATTTCT
TCTCATAAGCGATTGCCATAGAAGCTTCAGCAAAACCTCGAATTGACTCATCTGTGTTGTACATAGCCATGGCGACTCCTCCAGCACCAGTGAAGTTAAA
AACCTCAAGGTCAACCGTCTCGTCTTTTCCCTCGAAAACTAGTCTGAGTTTGCCAGGTCCCTTGAGAACGGCATCAGTTGCTCTGTACTGATCACCGAAA
GCATGCCTTCCAATGCAGATGGGCTTAGTCCATCCTGGAACAAGCTTTGGGACATTCTTGCATATAATTGGCTCTCTGAACACGGTGCCATTTATAATGT
TCCTAATTGTGCCATTTGGGCTCCTCCACATTTGTTTTAGGTTGAACTCCTTAACCCGATCTTCATCTGGAGTAATGGTTGCACATTTAATAGCCACATT
GTACTTGAGAGTAGCCTCTGCAGCCTCCACTGTAACCTTGTCATCAGTTGCATCACGGTGTAGAACTCCCAAGTCAAAGTACTTAATGTCCAAGTCCAAA
AATGGGAAGATAAGCTTGTCCTTGATAGACTGCCAGAATACTCTGGTCATCTCATCGCCGTCCATCTCGACGATAGGGTTGGCGACCTTGATCTTCTCGA
ACGCCATGGCGGCCGCGGCGGACGCTGATTGCCTCGGAGGTCGGGAGCGGGTCGGGGCAGGTTGGTGGGGTAGGCGGCGGCT
page-top