Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2344
Contig Information
Length 1730 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 12 Clones [Download: CSV  ,  FASTA ]
whgc10c21    whgc1k15    whgc5k08    whgc5p20    whgc12k02    whgc13c09    whgc14h03    whgc3c10    rwhgc5k08    rwhgc5n04    rwhgc7c16    rwhgc17f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Xylose isomerase >gi|1296809|emb|CAA64545.1| xylose isomerase [Hordeum vulgare subsp. vulgare]
Score 2302
Evalue 0
Total Hit Count 424
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2344
ACACTTCAGCCACTCTCCCCTAATCCCTATCCGGCCGCTTAACCAACCCCGCACGGATCGCGGAGCTGGTTGCCTCCCACTTCTCCGGCGGCCGCCGCGT
TGCAGAGACGTTTCGGTATGAGGAAGGGCGCGGAGCTCTTGGTCCTGCTGGTCGCGTCGTCCCTCTGCCTGTCCGCTGCGATTGCCGCGCAGGAAACCTG
CCCGGCCGACATCGACGCCAAGTGCGGCGATGCCGCTTCTGATGACTGGGAGGGCGAGTTCTTCCCCGGCATTACCAAGATCAGATATGAGGGTCCTACC
AGCAAGAAGCCGCTTTCTTACAAGTGGTATAACGCGGAGGAAGTGATCCTTGGAAAGAAAATGAAAGATTGGTTGCGGTTCAGCGTGGCGTTCTGGCATA
CATTCCGGGGTACTGGAGGAGACCCTTTTGGTGCAGCCACAAAGAACTGGCCTTGGGAGGATGGCACCAATTCCTTGGCCATGGCTAAGAGAAGAATGAA
AGCTCACTTCGAGTTCATGGAGAAGCTTGGAGTTGAGAGGTGGTGCTTCCATGACAGGGACATCGCCCCTGATGGCAAGACACTCGCGGAAACAAATGCT
AACTTGGATGAGATAGTTCAGCTGGCAAAGCAACTCCAGAGTGAGACCAATATAAAGCCATTGTGGGGGACTGCACAGCTTTTCATGCATCCACGTTACA
TGCACGGAGCTGCTACTAGCCCAGAGGTCAAGGTGTATGCTTATGCTGCTGCTCAAGTGAAGAAAGCTTTGGAGGTTACTCACTACCTAGGCGGTGAGAA
CTATGTATTCTGGGGTGGAAGAGAGGGTTACCAAACTCTTCTCAATACAGATATGAAGAGAGAACTTGAACATTTGGCTAACTTTCTTCAAGCTGCTGTT
AACCACAAGAAGAAGATTGGCTTTAACGGAACATTGTTGATAGAGCCTAAACCACAAGAACCAACAAAGCATCAGTATGACTGGGATGTTGCAACTACAT
TCTCTTTCCTACAGAAGTTTGGTCTTACAGGAGAATTCAAGATAAATGTCGAGTGCAACCATGCTACTCTCTCTGGGCATAGCTGCCATCATGAGCTTGA
GACTGCACGCATTAATGATATTCTTGGAAACATTGATGCAAACACTGGTGATCCGCAAGTTGGTTGGGACACGGATGAGTTCCTTACAGATATTTCAGAA
GCTACCTTGATTATGTCAAGTGTGGTTAAGAATGATGGACTTGCACCTGGTGGCTTCAACTTCGACGCCAAATTGCGGAGGGAGAGTACTGATGTTGAGG
ACCTGTTTATCGCTCATATCTCCGGGATGGACACCATGGCTCGCGGCCTCCGCAATGTTGCCAAGCTGATTGAGGATGGCTCCCTGGATGAGCTTGTCCG
CAAGCGCTACCAGAGCTTTGACACTGAGATTGGTGCCATGATCGAGGCTGGGAAGGGAGACTTTGAAACCCTAGAAAAGAAGGTCTTGGAGTGGGGCGAG
CCAACCGTTCCATCCGGCAAACAGGAACTGGCTGAGATGCTGTTCCAATCCGCTCTGTAGATCGGCCCACGGTTCTAGGAATAAAAGCAAGAGCACACCC
TCGAACGCCCAGTCCCCTCGCCACTACGGGCGATGTTCTATAGTTAGGCCTCCATGCAATGAACCCTGTAAACAAACTGCGTGGAGCTGAAAATAATGTA
ACATTGTATCAGAATTAAACTAGTTCGCCA
page-top