Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2328
Contig Information
Length 1123 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 10 Clones [Download: CSV  ,  FASTA ]
whgc10g06    whgc6o08    whgc13i09    whgc15p22    whgc19k14    rwhgc10g06    rwhgc13i09    rwhgc15p22    rwhgc19k14    rwhgc3i17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Mitochondrial outer membrane porin; AltName: Full=Voltage-dependent anion-selective channel protein; Short=VDAC >gi|456672|emb|CAA54788.1| voltage dependent anion channel (VDAC) [Triticum aestivum]
Score 1259
Evalue 1.7737e-136
Total Hit Count 378
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2328
TTTTTTTTTTAGTTCGGAATTTTCAGAGCTTGAATTATTACTGAGAAGTGTGGCTCAACGGACAGGCACTACACCGAGCAAAGACAAAATTCCTCAGGAA
TGAAACACGGCAGTTCTTCAAATCTAACAGACTGCAACAACGCGCCCAAGGCGTGTGAAGTATTGTCAACCCGCCCCGATTTCATCCGAAACCGAGGAAC
ACCCCTGACTGAGAGCTTTAGAGAATGGGGGGCTTGATTTCGCAATCAAGGCTTGAGAGCAATAGCAATGCCGACCTTCGAGCTCTTCTCGATGGCCTTG
GTGTCCACCTCCGCCGAGATGGTGCACAACGACTTTGGCATGAACTCGTGCTGGATCAGCGCGCTGGCCTTGCCAGAGTTGTTGATCCGGGCCTTCACAA
GGGTGAGCGGGTCCAGGGTATGCTGGGTGCCAAAGGTGAGGCTGTTCTCGTTGCTCGAGAAGCTGTGGGTCAGCTCCGCCCCGACAGCTGTGCCGGACTT
CTCCACAATGTGGTAATAGGATGCGGTCAGGCTGTCTCCCTTGTTGTTCAGGTTCAGGGATGCAATAAGATCCTGGTTAGTGTAGCTAAGTGCAGCATTG
TATTTGGTGAAATTCTTGGTGGCTGTATCAAGCGACACATCAGCACCAACAGCTAGAGCACTAGTTCCGAACGCACCGGAGAGGTTGACTACAGGATTGG
CAGTCAAGCCAATGCTTGCATTAATACCAGCATAATCATGCAAGTACTGGAGCTCAACCTTTCCAGATTTCTGATCAGGAACAGCAAAGCTCAAGATGGT
CTTCAGCCCTGGTGCTGCAAGATCGTCAGCGGTAATTGTAGTAATGACATTCGATGCTGAGTTTGCCTTCACATCTACAGTGATGTTTTTGTTCTTGATC
TGTGATTGGATCTCACCAAGTATAAGATCAGCCTTCTTTGTACTGGTAGCAGTAATTGCGGCGCCATNGGCGGTGTAGGTGGTGAGGGTGAACTTGTGGT
CGGTCTGGTAGTCCCTGTATAGCAGATCCTTGGCCTTCTTGCCGATCCCGGAGTAGAGGCCTGGGCCGCCCATCTCCGCCGGTGAGCTGGGATGCGCCTG
CGCCGCTGGAGCTGCGTGGGTTT
page-top