Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2324
Contig Information
Length 1598 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 10 Clones [Download: CSV  ,  FASTA ]
whgc10l24    whgc5m17    whgc13k16    whgc20b07    rwhgc10l24    rwhgc4f03    rwhgc5m17    rwhgc5n17    rwhgc16f09    rwhgc20b07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2273
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2324
GTCTCATAACATCCAGGTTTCACCAAAGCTTACATTAGGACAGTATGTAAGGCACAAGACAGACACCACCAAGGGCACGATATGCAGCGCTAACAGCTGA
ACAGCTAAAATATACCCAGTACGAACAATGCCCTTAACAAAACTCAGCCAATACTAAAAACTGCTTGGTGTCTGAAACAGTGATTTGGATATCAATTGTG
GAATTACTTCTTCTTGATGGCAGCCTTGGTCACCTTGGCCCCGGTTGGGTCCTTCTTCTCAACGCCCTTGATGACACCAACAGCCACAGTCTGCCTCATG
TCACGGACAGCAAAACGACCAAGAGGAGGGTAAGTGGCAAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACTATGCCAGCATCACCATTCT
TGAGGAACTTGGGCAGGGCCTCCAGCTCCTTACCAGACCGCCTGTCGATCTTGGTCACCAGCTCAGCAAACTTGACAGCAATGTGTGAGGTGTGGCAGTC
CAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCTGCCTCCTTGGCAGGGTCATCCTTGGAG
TTGGATGCAACAAACCCACGCTTCAGATCCTTCACGGCAACGTTCTTGACGTTGAAGCCAACGTTGTCACCAGGAAGCGCCTCCAGGAGAGACTCATGGT
GCATCTCAACGGACTTGACCTCAGTTGTCAGACCAGTGGGACCAAAGGTAACAACCATACCAGGCTTGATGACACCAGTCTCAACACGGCCAACAGGCAC
AGTTCCAATGCCACCAATCTTGTAAACATCCTGTAGGGGAAGACGGAGGGGCTTGTCTGAGGGCCTCTTGGGCTCGTTGATCTGGTCAAGTGCCTCAAGC
AGGGTTGGGCCCTTGTACCAGTCAAGGTTGGTGGACCTCTCAATCATGTTGTCACCCTCGAACCCAGAGATGGGGACGAAGGGAACCTTGTCAGGGTTGT
AGCCGACCTTCTTCAGGTACGAAGAGACCTCCTTAACAATTTCTTCGTAACGAGCCTTCGAGTACTTGGGAGTGGTGGCGTCCATCTTGTTGCAGCAGCA
GATCATCTGCTTCACTCCAAGAGTGAAAGCAAGGAGGGCGTGCTCACGTGTCTGGCCATCCTTGGAGATACCAGCCTCAAAACCACCAGTGGTGGAGTCG
ATGATGAGAACAGCACAGTCAGCCTGGGAGGTACCGGTGATCATGTTCTTGATGAAGTCACGGTGACCAGGGGCATCAATGACGGTGCAGTAGTACTTGG
TTGTCTCAAACTTCCAGAGGGCAATATCGATGGTGATACCTCTCTCACGCTCGGCCTTGAGCTTGTCAAGCACCCAGGCGTACTTGAAAGACCTCTTGTT
CATTTCAGCGGCTTCCTTCTCGAACCTCTCGATGACACGCTTGTCAATGCCTCCAAGCTTGTAGATCAGGTGGCCAGTGGTCGTCGACTTACCAGAGTCG
ACGTGGCCAATGACCACGATGTTGATGTGAGTCTTCTCCTTACCCATGGCTGGTGGGTAGACGTAAACTACCCAACCCGAAGAAGAAGAACGAACGGA
page-top