Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2327
Contig Information
Length 767 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 10 Clones [Download: CSV  ,  FASTA ]
whgc10d20    whgc1o18    whgc2o14    whgc2p02    whgc16o21    rwhgc10d20    rwhgc11c07    rwhgc1o18    rwhgc2o14    rwhgc16o21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13062 [Oryza sativa Indica Group]
Score 367
Evalue 2.54456e-33
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2327
TTCGGCACGAGGCATTCCGATCCGTTGGCTTCCTGTTCATACATTCTCCCCTCCCGGCGCCGCCTCCAGCCTAGGGTTTCCTCCCGCCGTCCGCCGCCAT
GGCTCGCCGCAGCGGAGGAGGAAGGTCTTCCCGCCCTGCTCCACGTGCTGCTCCAGTGAGAAACCCACCAGCGCCAGCCCGTCAAGCTCCTCCACCTGCT
ACTACCCAGAATAGCGGTGGTGGTATCATGAGTGGAATTGGGTCCACCATTGCTCAGGGCATGGCTTTCGGTACTGGCAGTGCCATGGCGCACAGGGCTG
TTGATGCTGTGATGGGTCCCCGCACCATTCAGCATGAGACTGTTGTCGGTGAGGCTGCTGCATCTATGACTCCAATGGACAATGCTGCTGATGACAAGTG
TGGCAACCCTTCCAAGGCCTTCCAAGATTGCATCAACCACTACGGAAGCGACATCAGCAAGTGCCAGTTCTACCTCGACATGCTGAACGAGTGCCGCCGT
GGAGGAGCAGGAGCTGGTGCAACTCTTTAAGCTACTATCTTTGCTTGATTGCGGCTTAATTGGTCGGAACCTGTTTTCAGTCATGATGATGATGATATAT
ATCTCCTAAATAATTCATTGGCAATATTATGAACCTATGCCACAGCTTATGTCTATTACCTACCCTAGTTTGTGGTCTCTGTTGTCCTGGGAGTATTTCC
TTGTATTGATGTTGGAATTACCTTCATGGCAGTGGGTTTATAAATATGGAGTTTAATNAAAAAAAAA
page-top