Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2277
Contig Information
Length 1092 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 8 Clones [Download: CSV  ,  FASTA ]
whgc10e15    whgc4d17    whgc13l22    whgc14k09    rwhgc10e15    rwhgc4d17    rwhgc13l22    rwhgc14k09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194707896|gb|ACF88032.1| unknown [Zea mays]
Score 536
Evalue 3.70919e-62
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2277
CTTTCCCCTTCTTCGTACGCCTCCAGGCCATCTAGCTCGCTCGGATTACGGCCGTCGGCGGCGGTGCTTCCAGAGGTGAGCGGCATGGCAGGGGCGGGGG
CGGAGGAGGCGGTGGTGGGCGAGAGCTTCGAGTTCGCCTTTGACAAGGAGGCCTTCTCCGACAAGAAGCTGCGGGTCGAGGTCGTCGGCAGCGACGACGC
CGCCAGCCGCAAGCGCCGCCGCGAGGACGACAAAAGTGATGAAGGAGAATGTGTTGATTCTTCTTCTATAGTGATGGCTGCACCAACTTTACGAGTCACT
ACCATGCATATCAATTCGGCCATTCTTGCTGCAAAAAGCCCTTTCTTTTTCAAGCTTTTCTCAAACGGCATGAAAGAGTCTGACAAGGGACAGGCAACAC
TTCGAATAGCTGATTCAGAGGAAAATGCCTTCATGGAGCTTTTGTACTTTATGTATAGTGGAAAGTTGACACCAACAACTGAGCCCACTCATCTGGTTGA
TATCTTGATGGCCGCTGACAAATTTGAGGTCATTTCTTGCATTAAGCTTTGCGGTCAGTTGCTCACAAGCTTGCCTATGACCCCAGAATCTGCAGTGCTG
TGCCTAGATCTACCATATTCCATTTCAATGGCACCTGCCCTGGCAGTGGCAGCCAAGAAATTCTTTGCTGAAAGATACAAGGATTTCCTGTCAACAAAGT
TACAAGACGAACTGATGAGGATCCCTCTCGCAGGATCCTAGCCATCTTATCAAGGAATGACCTCGGAGTTTTACCTGAAGAAGCCGTCTATGACTTTGTG
CTCAGGTGGGCTGATTCGCAGTACCCAAATCCAGAAGAAAAACGCAAGATCTTGAGTTCACAGTTACTTCCACTAGTACCACTAGTGCGAAGTAGAGTCA
GAACCATTGTACTTGATTAGCCGTCTTGTATAATCAACTTCAGTCTAGAGTTGATTATCTTGTATGTGGTAGACCCTGTAGGGCTGTAGGCTGGTGAGAT
ACATAGTCTGGTTTGTGTGACTAGTGTACCGTGTTGTTGCCGTGTTTGTCCTGCTATGCAGCAAAGTCGCTGAACCTGTCTTGTCGGAAGTG
page-top