Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2262
Contig Information
Length 783 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 7 Clones [Download: CSV  ,  FASTA ]
whgc19a10    whgc19h17    whgc19m08    rwhgc10f21    rwhgc19a10    rwhgc19h17    rwhgc19m08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100217027 [Zea mays] >gi|194697434|gb|ACF82801.1| unknown [Zea mays]
Score 956
Evalue 1.33188e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2262
TTTTTTTTTTAAGCAGCAAATTAGATGGTTCGATAGTAAAGGTTCTGAGGCACCAAGTGCGGCAACCAGCTTAGGAACACAACATCCCAGGAGTCCAACA
GGCCATCACAGGCCACTACTACATACTACTAGTACTAGATAACCAAGCGCATCGCCAAAAGTTGGAACGCGCAAGTGCGGCTGGCTGGCTGGCTCAGCAG
AAGAACATGCTGCTGCGGACTTTCTCATGGAGGCGAGGCAGCTCCTGCACTGGAGCGCTGCCGGCAGAGGTGTGGCCACCTCCCTGGCTCGACGACGTCT
CGGACATCTCATCAAACTTTATGAACTGCGCCACCTGAGCAGCCGCAAGATGTGCATAGCAGATTGGAGAAACAACTGATATGGCTGTCGTGCTCCTTTG
ATACACATATGAGAGCGAGTGCACAAGATCCTGCAGGTCATCCGCGGCAAAGTGTATCTCATCATGCAGGATATGGTAGTGCGTTGGCCTTGTAGTCCCA
ATCATTCCAGCATGAGCGCACATGTAGAAGTCATAATTCCTTGGATGGCAGACTGCATTATCTACAACAGTGCCCGGAGGGACATTGTCAGGAGATCCAG
GTATGAAGAACTTGGTGTGGTGATTTTTCTGAGCAACAATCAGCGTGAACTTGGGGTTCCAGTTTTCATCCAAGAACTTGCAGGCCTCAATTATTTGATC
CAATTCAATGTTCAGCACCTGATTAAACTGGCTCTCACTAACACCATCCCTGAAGATGATGATCTGATCTGGTTTCCTTTTTC
page-top