Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2257
Contig Information
Length 661 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 7 Clones [Download: CSV  ,  FASTA ]
whgc9h13    whgc9h14    whgc9j14    rwhgc10g01    rwhgc9h13    rwhgc9h14    rwhgc9j14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21076 [Oryza sativa Indica Group]
Score 782
Evalue 1.40336e-81
Total Hit Count 128
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2257
TTTTTTTTTTATCCCGACGAACCAACTTTTATTATTCTGGAAACGAAGACGACTCACTCAGTCCACCACCAACAGGGGTCTCTCTCTACCTGACAGCAGT
TCACAACTTCAAACAGCTAGTCGCACGCATACATTACAGTCCATGAATTGTCCACCCATCAAAAAACAACTCTTCGGCCCCAAACCTAGGCAGACTGCCG
GAGCTCTGGGCGCACAAAGTCCGCGTCGGCCGTCACCGAGATGTCGACGGTGGGCCTCAGCTCGGCGCAGACCTCAATGGCGCCATGGACAGGGTCTGAC
ATGAAGTTGCTGATGAGGTCCTGGTTGACGGGCTCGTCCTTGTCCACCGTCACAAACGCCTGCTGGGTCAGGATGTAGTCGAAACGGGGCGCCCACTTCC
TCGACCCCAGCCGTGCCGTCGTCGAGCAGTTGTCCACCATGAAGGCCACCCCTCGCGCGTGCATGAACGGGTTCAGCGAGTCCACCGACTCGATCACGCT
CTCGTTGATGATCTCAGAGTAGGAGTGCCCCTTCTTCCTCAGCACCTCAATCTGGGCCATCATAAGTGCAACATAAACTCCAGCCGTGAAGGGGTGGAGA
GGGCCAAGGTCACCATCTGGCCGGGTCGAGCGCACCTTTTCGCCAACCTTCCACATCCGAG
page-top