Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2247
Contig Information
Length 757 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 7 Clones [Download: CSV  ,  FASTA ]
whgc10c04    whgc7m01    whgc13g19    rwhgc10c04    rwhgc13g19    rwhgc16m17    rwhgc3m14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_023051 [Oryza sativa (japonica cultivar-group)]
Score 124
Evalue 3.70437e-05
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2247
CCTGATTCAGAATCTCTTCCTCTGTTTTCTTTGTTGGGATTGATGTAATCAAGAAGATCAGATACACTTAGGTGTCCTTTCAAATCCTGACTCCGCCCAT
GATGTATTCCCACATTAATCTCATTACACAACACGCACATAGATGAGATATTCAGCAACACGCATGATCACTGGTGAGCTGATGAATTAGCTCTGTACCC
AGCTTAGCTAGAGCTGATGAATTAGTTCTTCATCTATAGAGTAACCTTATACAATAATCTATATATACTCATAATGGCTTTGTGCTATATATATGACAAG
CTCTGTTTCAAATATGTGCGCATAGACGTCATGGTGTATAACCATCAGTTGTTGCTAGTGTTGGTCGACACAGATACAGTGGCCGACGACGGGCACGGTG
GCTTCGGCTTCGACTTTGCCTTCGGTTTCGAGTTAGTCTTCGACGGACACGGTAGCCTTGGCTTCCGTGCATTAGGATGGCACGGCCGCTTTAGCAGCGG
CTTCGGCGGGGTTGGTTTCGGCGGCATGGGCGACGGCGGCGATATGGGCGACGGTGGCGGCATGGGCTTCGGTGGAGCGGGCTTTGGAGGTGTGGGCTTT
GGTGGCGTCGGCTTTGGCTCCGGCTTTGGTGGCTTCGGACTCGGGGGCTTTGGACCCGGGCTTGGGTGGTGGTGGTGATGGTGATGGTGGTGGTGGTGGT
GGTGGTCCAAGCATTTGTGCCCGCATGATTTGTAGCAATCCGCCTGTTTATAGGGTG
page-top