Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2240
Contig Information
Length 624 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 7 Clones [Download: CSV  ,  FASTA ]
whgc10g02    whgc16j10    whgc17f17    whgc17p22    rwhgc10g02    rwhgc17f17    rwhgc17p22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 426
Evalue 2.35752e-40
Total Hit Count 37
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2240
GATCGGTTAAATCACCCCCAAAACGCACCCACCACCACAACTCCGGCGGCGGCGACCAGACGAACACGAGCACGAAGGCGATGGCGACTGCTCTCAACCG
CGGCCTCCGCTCCGGGATCCGCCTCCTCGCCACCGGCGCCGAGGCCTCCAAGCCAGCTTCACGTGGATTCCATGCTACCGGCGTGAAGAGGATGTCAGGG
CACGGCCATGATGAGCCATACTACCTCCACGCCAAGCACATGTACAACTTGCACAGGATGAAGCATCAGAAGCTGACTGCATGGACTTCAGTGCTGGGAG
CCGTAAGCATTGGTGTCGGTGTCCCGGTCTTCGCGGTCATCTTCCAGCAAAAGAAAGCCTCCGGATGAGCTCACATACCCTCCCAGGGCCTACTTATTGG
ACCTATTTTGAATTTAGCATTTTGTGAAGCCAAAGCTGTCACTTCACTTGACTCTTGTTGTTTCGTGTTACTCCATTTGCTGTTAGCAGATGATCTGAAT
CTGTAAGCTCGTTTCTTTACGGCACTGCTTTTCTGTTAATAATACAAGTGGCTTGAACTTTCCAGGCTGTGGAGAAACCCTGCAGTGTGATCCAATTGTT
GTTTGCGTTCCTCTNAAAAAAAAA
page-top