Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2229
Contig Information
Length 778 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 7 Clones [Download: CSV  ,  FASTA ]
whgc9k02    whgc9k13    whgc19d19    rwhgc11b13    rwhgc9k02    rwhgc9k13    rwhgc19d19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phosphoethanolamine methyltransferase [Triticum aestivum]
Score 837
Evalue 8.31565e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2229
TTTTTTTTTTAGCAACAGAATAGCACGTTACAAAGCGAGTCTCGCTCGTCACAGTACAAGTTCAGGAATACAGTACGTACGTACGTACACATTATCTTAC
AGATCCTGGTGCCCAGCCAGTGAATGCAGCCACTGCAACAAACAAACAATCACACCCAACACACGGCCACAACATTGTCGAGCACCGATCCTCTTTATTT
ATTTCTTAACAGAAGCTGCTCTGCTCCCGAATCATCGCGTCCATGGCGTCGCTGCTCAGCGGCCAGATCACTTGGTCGCGATGAACAGCCCCCACTTCTG
CTCGCCGGCGAAGCTCCGCTTCAGCTTCGCGCTCCAGCCGTTGACGATGTCGTCGTAGTCCTCCTGGGTGAAGTCCGCCAGGAAGGCCTCCTTGTTCTTC
TCTGTCTCGCCCAGCTCCCTCTCCAGGACCCTCAGGAACTGGTCGGTGCGGTCTTCGGCGACAACATCGTGGAAACCGGCATCCTCAAGCATCTTCCCAT
AGGTCTTCACATCATGGAGGTCATAGCCTCTCTGCTTGATGTACGCAGCGAATTCCTCTGATGGTGTGCCAGGGCTCCTGCAGTAGTCACTGATCAGCAC
TTTGCCCCCAGGCTTGAGCCACTTGAAGAAGTTTCTGAACAGAGCAGGTTTGTCTTGGATGTGGAGGATGGTGTCACGGCTGTANATGACATCAAACGTG
TTCTCTGCATATTCCTTGGTGGTGCANTCANCAACCTCAAACTCAACCNANCACNANCGCCCNATGGCACNCTCNATC
page-top