Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2211
Contig Information
Length 847 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
rwhgc10c21    rwhgc1k15    rwhgc5p20    rwhgc12k02    rwhgc13c09    rwhgc3c10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Xylose isomerase >gi|1296809|emb|CAA64545.1| xylose isomerase [Hordeum vulgare subsp. vulgare]
Score 1005
Evalue 3.21007e-107
Total Hit Count 325
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2211
TACACAACCCTTAGACCGATGAGCATCTGGGTGAAACACAGGGAGAAAATTGGAACATAGTTCAGCCCAACTCCCATGTTGGCGAACAAGTTTAATTCTG
ATATAAGGTTACATTATTTTCAGCTCCATGCAGTTTGTTTACAGGGTTCATTGCATGGAGGCCTAACTATAGAACATCACCCATAGTGACGAGGACGACT
GGGCGTTCGAAGGCGTGGTCTTGCTTTTATTCCTAGAACCATGGGCTGTCATCTACAGAGCGGATTGGAACAGCATCTCAGCCAGTTCCTGTTTGCCGGA
TGGAACGGTTGGCTCGCCCCACTCCAAGACCTTCTTTTCTAGCGTTTCAAAGTCTCCCTTTCCAGCCTCGATCATGGCGCCAATCTCAGTGTCAAAGCTC
TGGTAGCGCTTGCGGACAAGCTCGTCCAGGGAACCATCCTCAATCAGCTTGGCAACATTGCGGAGGCCACGGGCCATGGTGTCCATCCCAGAGATATGGG
CAATAAACAGGTCCTCAACATCAGTACTCTCCCTCCGCAATTTGGCGTCGAAGTTGAAGCCACCAGGTGCAAGTCCATCGTTCTTAACTACACTTGACAT
AATCAAGGTAGCTTCTGAAATGTCTGTAAGGAACTCATCCGTGTCCCAACCAACTTGTGGATCACCAGTGTTTGCATCAATGTTTCCAAGAATATCATTA
ATGCGTGCAGTCTCAAGCTCATGATGGCAGCTATGCCCAGAGAGAGTAGCATGGTTGCACTCGACATTTATCTTGAATTCTCCTGTAAGACCAAACTTCT
GTAGGAAAGAGAATGTAGTTGCAACATCCCAGTCATACTGATGCTTT
page-top