Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2208
Contig Information
Length 910 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whgc10b21    whgc10b22    whgc13n14    rwhgc10b21    rwhgc10b22    rwhgc13n14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Ubiquitin-conjugating enzyme E2-23 kDa, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|218184640|gb|EEC67067.1| hypothetical protein OsI_33825 [Oryza sativa Indica Group]
Score 822
Evalue 6.01474e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2208
AGCAGCTCAATCTCTTTCTCCTTTTCTTTTCTCTGCCCCCTCCCTTATCCCCACGCCCAGGAAACGCGTCTCCGGAGGAGGAAGGGAAGATTTCATCTTT
TTTGCCCCCAAGATGTCCTCCCCAAGCAAGCGCCGCGAGATGGACCTCATGAAGCTGATGATGAGCGACTATAAGGTGGAGATGGTGAACGATGGGATGC
AAGAATTCTTCGTGGAATTCCGAGGGCCTACTGAAAGTATTTATCAAGGTGGTGTCTGGAAGGTTAGAGTAGAACTGCCTGATGCATATCCTTACAAATC
TCCGTCAATTGGTTTCATTAATAAGATTTATCACCCGAATGTGGATGAAATGTCTGGTTCCGTATGTTTAGATGTTATTAACCAGACATGGAGCCCAATG
TTTGATCTAGTAAATGTGTTCGAAGTCTTCCTTCCACAACTTCTGTTGTACCCAAATCCGTCTGATCCATTAAATGGAGAGGCTGCTGCACTTATGATGC
GAGATCACCCTGCTTATGAACAAAAAGTGAAAGAATTTTGTGAAAAATATGCGAAACCAGAGGATGCTGGCATAACCCCAGAAGACAAGTCCAGTGATGA
AGAGGAGCTTAGCGAAGACGAAGATGACTCCGGCGATGAGGATATAGTGGGCAAACCAGATCCTTAGTCACTACCACAACCCGTTGTATACAATGTTGGT
TGCAAAATTTGCAATCAAATTGATCCAGAAAATCTGGGAAAGAGAACTTTGTATGTCATGTAAATAAGTGTACTTGTATCTTATCCAATGTTGTTTTCTT
CAGTTGACCAATTGATTTTGCAGCATTGCATACATTCGCGCCTGTCCGTCTTTGTAGATCTGTGATCTGGTTCATAGAATAAAACAAGGGGTTAGCTTCT
AAAAAAAAAA
page-top