Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2206
Contig Information
Length 720 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whgc10c12    whgc1c18    whgc14j06    rwhgc10c12    rwhgc10n02    rwhgc1c18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_06649 [Oryza sativa Indica Group]
Score 784
Evalue 9.93708e-82
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2206
CTCCTCTCGATTTCGATTGGAATCGGAGCCAGCTCCGCTGCCTGATTAGCCGGCCGGCCCCGGCCCCGTCTCCGTCCCCATGGCGTCCAAGCGGATCCTC
AAGGAGCTCAAGGACCTGCAGAGGGATCCCCCCACCTCCTGCAGCGCCGGCCCTGTGGCAGAAGATATGTTCCACTGGCAAGCAACGATCATGGGCCCAT
CGGAAAGCCCATATGCTGGTGGTGTATTTTTGGTTACTATTCACTTCCCCCCAGACTACCCATTCAAACCACCGAAGGTTGCATTTAAAACAAAGGTTTT
CCACCCAAATATCAACAGCAATGGGAGCATCTGCCTTGATATCTTGAAGGAACAATGGAGCCCTGCATTGACAGTTTCAAAGGTGCTCCTTTCAATCTGC
TCTCTACTAACAGACCCGAACCCCGACGACCCGTTGGTTCCGGAGATTGCACACATGTACAAGAGTGATCGTGCGAAGTATGAGTCCACAGCGAGGAGCT
GGACCCAGAAGTATGCAATGGGCTGACCTTGTGAGCCTAGGTGGAGGATGATGTTGGAGCCATCTTCGCTTGTTACACCTAATGTATCTTTGTTCCTGTT
CTGCTGCTGCTATATGGGATTGTACTGTCCACCTACCTGACTGAATTCAAGTGTCATATTGTGAAGTGATGGCAGAAGGCCTCTATGGGTCTATGGGTGC
ACCCATCCAACAAATTAATA
page-top