Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2195
Contig Information
Length 1274 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whgc12k01    whgc18a10    whgc3d11    rwhgc12k01    rwhgc18a10    rwhgc3d11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1636
Evalue 4.07999e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2195
TTTTTAATCAGGTGTCAAATTGTTTCACTCTTGCAGCAAATGTACTGTCCTGTAAATCATCAGGCAAAAGGGGAGCTACAAGCCTCATTCATACACACTT
GGAAAACCAGCGAAAAGGAGCATGCATCGCGATGTGCGGCTGTTCTGGGTGGAGACGAGAGTTTCTAAAGAGCGGAAGGTTTCATTTATTCAAAACATCC
AGAGGAGCAGCTGCCCTTCGAATGTGGATTTACGCCAGGCATGAGTAGGCCAACGCCTTCTCCTCTGACAGCTCCTGGGCGGTCGCATCCATCTTCTTCC
TCGAGAACTCATCGATCGGGAGCCCTTGAACAATTGTCCATTCACCACCACTGCACGTTACTGGGAAGGAGTAGATAAGACCAGCAGGCACACCGTATGA
ACCATCAGAGTACACACCCATGGAAACAAATGTTCCCTCAGCGGTTCCCAGAACCCAGTCACGGATGTGATCACAAGCTGAGCTGGCAGCAGAGAGAGCA
CTGGAGAGCTTCCTCGCTTTGATGATTGCAGCACCACGCTGCTGGACAGTGGCAATGAACTCCCCATTTAGCCATTCATCATCTTGAACAAGTTCACGAA
CAGGCTTCTCTCCACTGGGAGTCTTCACAGTGGCATGGTTAACATCAGGATACTGACTGGACGAGTGATTACCCCAGATAATAGCATTCTTAACGTCAGA
AACTTGGACACCAAGTCTCTCAGAAATCTGACCGAGTGCCCTGTTGTGGTCTAGGCGGGTCAAACAACTGATGTTCTTCTCAGGGATAGATGGAGCAAAC
TCCTTCAGGATGAGAGCATTGGTGTTTGCTGGGTTGGCAACAACCAAAACCTTGCAATTGGGGGCTGCATGAGCTTCAAGAGCAGATGCTTGAGCTTTGT
AGATTGAAACATTTTTCGTCATAACATCCTTCCTTTCCATTCCTTCCTTCCTGGGGAATCCACCAACCATAACCGCAACATTCACACCAGTGCAAGCCTC
AACAACATCAGTTGTTGCAACAACTCCCTTGAGAAGTGGAAATGCGGCATCGATCAACTCCATCTTGACGCCTTTAAGAGCTTCAGCAGCAAATTCAATA
TCCAGCATATGCAGAATAACAGGCTGGTCTGCACCAAGCATAACTCCCCTGGCAATCATGGGAACAAGAGCATATCCGATTTGTCCTGCGGCGCCGGTGA
CGAGCACGCGCATCGGTTCCTTCGCCGCCATTGGAGCCGGGGGGTAGATTCTGGACACGGGGATAGGGAGAGTG
page-top