Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2181
Contig Information
Length 855 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whgc10c11    whgc10i14    whgc20k12    rwhgc10c11    rwhgc10i14    rwhgc20k12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_000218 [Oryza sativa (japonica cultivar-group)]
Score 423
Evalue 9.97842e-40
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2181
TTTTTTTTTTCAAGTTTCAACAGCACTTTTGATTTAAAAACCAAAACTGTCTCAGACCAACACGACAGGCAGGATTTCTAATCAGTCCACAAGGTCGGGC
CATTTGGCCCGAACCTTCTCATCCTCCTCACGGATATCATCAGTCTACGGATTAATTAACATAACTTAAAAACAACTGTCGCTGCCACCTCCTCCCAGGA
GGAACTGTCTTGGGATAAAGGTGCTAAAAACGGTAAACAACTCAGACGAACTAAGTATATCTCTCTCTTTGTCTAGGACCTATCCTCTCCCCTCTTTATT
TCTCTCCCCTCTCCACTCTCCACTCTCAGTATAAACGCTATGTTCAGAAGGACCGCAGGTACTCCGACGCCATGGCCTGGAGCTCCAGCGCCATCGCCTG
GAGCTTCTCAAGGTCGGCGGTGAGGTCGAGGTTGGGGGAGAGCATGAAGCCGGCCCCGGCCGCGAGCGCGATCACCAGCAGGCTGCCCTTCAGGCAGGTG
GCGCCGCGCGACAGCCTCCCGATGATGGCCTTGCAGTACTTGTCTGCCTCCTTGATGGACGCCTTCTCCCCAGAGTCCTCTGCTTCCTCCAGAGCAGCCT
CATTCTTAGCCTTGAGGCTCTTCAGAGTTGCTTTAAGAGCTTCAGAGTTGAGCTTGGGAGAGAGTGTCTTCCAGTCTGCAGTGATTTTGCGCAAGACCGC
AACACTGGCTTGGATATTCTCTGCATGAAGCTTGTCCCACAGCTTGTAGGACTCTGGACTCTGAGTCAGGCACCAGATGAACACATCGGTGGCCTCCTTG
GCAAGCTCTGCATTATTTTCTTGCATTGCCTTCACAGCCAAAGGCAGAAGCTGCT
page-top