Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1715
Contig Information
Length 679 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 12 Clones [Download: CSV  ,  FASTA ]
rwhfl42o10    rwhfl9b20    rwhfl51d16    rwhfl27d20    rwhfl10a07    rwhfl10a08    whfl51d16    whfl42o10    whfl27d20    whfl9b20    whfl10a07    whfl10a08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit dihydrolipoamide dehydrogenase [Bacillus sp. SG-1] >gi|148850416|gb|EDL64577.1| dihydrolipoamide dehydrogenase [Bacillus sp. SG-1]
Score 83
Evalue 1.69506
Total Hit Count 3
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1715
taaatAAGTCATACAAGCATCATAATACAAGCCAGGGGCCTCgcaGGGCTCGAATACAAGTGCTCGATCATAGACGAGTCAATGGAAGCAACAATATCTG
AATACAGACATAAGTTAAACAAGTTTGCCTTAAGAAGGCTAGCACAAACTGGGATACAGATCGAAAGAGGCGCAGGCCTCCTGCCTGGGATCCTCCTAAA
CTACTCCTGGTCATCGTGAGCGGGCTGCATGTAGTAGTAGACACCTCCGGTGTAGTAGGAGTCGTCGTCGACGGTGGCGTCTGGCTCCTGGGCTCCGGCA
TCTGATTGCTCTGGCAAGGAGGGGTCGTCAACACCATAGTCGTACTGGGTAGCAGCGGCGTCGGTCTGGGTGTATCTGAGCTCGGGAAGACTCGGGAAAG
CCGAAGGAACTCGGGGTGGCGCGGATCGAACGACGGACGGCGGCGGCACCGAGGTTGAAGACGGCCTCGATCCCGTCATTGTAGGGCTCCCCGGCGTCGA
GTCTGTGTTGTAGATGGCGTA*GGCGACGATGTCGGTCCTCCGGGACACGGTGGT*GCGGCGCGGGGCAGCTGGTGGTCGCGTGAGCAACGACGGCGCGG
CCAGGGGCATTTCGGGCATGAAGAAAAATAAGGGGACGAGCATGGGAGGGGAAGAAACGGGGCTCGgttctcgacgaat
page-top