Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2096
Contig Information
Length 892 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 5 Clones [Download: CSV  ,  FASTA ]
whgc10a08    whgc19e06    rwhgc10a08    rwhgc9j20    rwhgc19e06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_30272 [Oryza sativa Indica Group]
Score 304
Evalue 6.74606e-26
Total Hit Count 51
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2096
ACGAACTGATAGGCTCACTCATTCATTACAAAACAGACATGGGCAAACAGTTAGCAGCAGCTACTCTAGTTTGCCCTTTGCTGCAGTGCTATCTACCTGG
CCATCTCAAATCTTCACCCAGGCTCCTAACCAAAAATATTTCAAGCTGAGCAATTACCAAGGCTAGAATAAACTTACAATCTGCTCACCGCAGACCAACA
TAGAAAAGCTTTCGGTTTCCCTTTCGCCGTCAATTTGGACAAAACAACAACTTGTTACATGAATGCTAATGCACATTTCATTCTACAACACATCAACACC
ACAATTCCCCACCAATTAGCTGGCTACACCGCCCCCTTCAAGCTGCTGCACCTGTCATACCCTCCTGTAATTCGGATTGATTCCGTAAGGTAACCAGCTA
TTGTCATCATACAGGACCTCATGTGCCCCGTTGAAACCATGGGGGTGAAACGACCTATTAATCGCTGGCTGGTGGACTGGCAAAGGAACAAACATATGCC
GGGCTTGCTGCTGCAGTTGAATCCCAGGATCCGTCGAGTAGATGAAACTACCATGAGGTTGTCCTATCATATGAGGACCTGGATGAAAGTGTGCTTGTGG
CAACCCGTAGGAAAGCTGAGGAATCGGAAGCTGAGATGGATGCACAATCTGATTAAATGGTTGGGTAGAACCTACTTGATGCACATGAGGCATAAATACA
GTGGGAGTTGGTAAAATAGAATCAATCCTGTTAGCAGCGCGGCCGCGTTGTGCAGCGTGCTTCACTTTCTTTTGCTGCTTCTCACTGTTTGCAGGGTCAT
GTCGCAACTCCCTCTTCCTCTTGCTCTTAACATGTTTTGGACTGGGGTGACTGACTGGCACATCCTGATTTAACGCCCCAAAAATGAGGATC
page-top