Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2094
Contig Information
Length 1229 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 5 Clones [Download: CSV  ,  FASTA ]
whgc10g15    whgc5i10    whgc19k04    rwhgc10g15    rwhgc19k04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1202
Evalue 8.24402e-130
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2094
CTCCTATTCGCGCCGCCGCTCACATCCCTCCCCTCCTCCTCCCCTTCGCGGCGCCACCCGGACGCTCGAGCCCCCGACCAACCATGGCGGCAGCGGCTGG
AGAGGCCCCTCGGGCGCTGTCCCAGAAGGAGCAGGACATACAGATGATGCTCGCCGCCGACGTCCACCTCGGCACCAAGAACTGCGACTTCCAGATGGAG
CGCTACGCCTACAAGCGCCGCTCCGACGGCATCTACATCATCAATCTGGGCAAGACATGGGAGAAGCTCCAGCTCGCGGCGAGGGTCATCGTCGCCATCG
AGAACCCCCAGGACATCATCGTCCAGTCCGCCCGCCCCTACGGCCAACGCGCCGTCCTCAAGTTCGCGCAGCACACAGGCGCCAACGCCATCGCCGGGAG
GCACACCCCTGGAACCTTCACCAACCAGATGCAGACCTCCTTCAGCGAGCCCCGCCTGCTCATCCTCACCGACCCAAGGACTGACCACCAGCCCATCAAG
GAGTCTGCTCTGGGGAACATCCCTACCATTGCCTTCTGTGACACTGACTCTCCCATGCGATACGTTGATATCGGCATCCCAGCAAACAACAAGGGGAGGA
ACAGCATTGGCTGCCTGTACTGGCTCTTGGCCAGGATGGTTCTGCAGATGAGGGGTACTATCCTGCCTGGGCACAAGTGGGATGTCATGGTTGATCTGTT
CTTCTACAGGGACCCTGAGGAAGCCAAGGAGCAGGAGGATGAAGCTGCTGGAGCCCCAGAGTATGCTGCCATCACTGATTACGGAGCTGCAGCTGGTCAA
TGGGGTGGTGACCAGTGGACCTCTGATGCACCTGCTCCCCCGCCTGTTACTGGTGGCGAGTGGCCGATGGCTGAAGCTCCAGTTGCTGGTGGCGATGGAT
GGGATGCAGCAGGGGCACCTGTTGCTGTGGAAGGTGCCGTTCCTGCTCCTGTTGTGGCTGCTACTGGCTGGGACGCCGCGGTGCAACCCCCTGCTCAAGG
CTGGGAGTAGACTAGGATGCTCCCTTGAGATGTCTTTGTGGCTTAAAGTTCATATTTTGTGAGGCATTAATGGATATCTAGCATCTGATGCGATCTGCTA
TATCTACCCTATGGACAAAAACCTGTGTTTTAGGATTTTCTAGATGAATTTGTGATCTCTGCTATCGACATCGTGATGAGGGAGAGGGAGACTGAAAGTT
TGTGTTATAAGTTGGCTTTAAAAAAAAAA
page-top